Table 1.

qRT-PCR primers.

Target geneForward primer sequence (5′-3′)Reverse primer sequence (5′-3′)
TXNTGAAGCAGATCGAGAGCAAGACTTCATTAATGGRGGCRRCAAGC
DUSP6CCTGAGGCCATTTCTTTCATAGAGTCACAGTGACTGAGCGGCTAAT
NFKB2GAACAGCCTTGCATCTAGCCTCCCAGTCGCTATCAGAGG
RELBTCCCAACCAGGATGTCTAGCAGCCATGTCCCTTTTCCTCT
TXNRD1GAAGATCTTCCCAAGTCCTATGACATTTGTTGCCTTAATCCTGTGAGG