Table 1.

Primer list

Gene nameGenbank accession no.Sequences
TNF-αNM_000594Forward: ATGAGCACTGAAAGCATGATCC
Reverse: GAGGGCTGATTAGAGAGAGGTC
IL-1βNM_000576Forward: CTCGCCAGTGAAATGATGGCT
Reverse: GTCGGAGATTCGTAGCTGGAT
IL-4NM_000589Forward: CCAACTGCTTCCCCCTCTG
Reverse: TCTGTTACGGTCAACTCGGTG
IL-10NM_000572Forward: ACTTTAAGGGTTACCTGGGTTGC
Reverse: TCACATGCGCCTTGATGTCTG
IL-13NM_002188Forward: GAAGGCTCCGCTCTGCAAT
Reverse: TCTGGGTCTTCTCGATGGCA