Table 1.

List of primers used in RT-PCR

GenePrimer pairs (sequences 5′→3′)
ForwardReverse
Nrf2TCACCATCTCAGGGGGAGCAACATACTGACACTCCAATGC
Cul-3AGAGCGGAAAGGAGAAGTCGTAGACTCAAAGTCACCCGCAATAGTT
Keap1CAGCCAAGGTCCCTGAGTGTGTAGCTGAAGGTGCGGT
γGCSAGAGAAGGGGGAAAGGACAAGTGAACCCAGGACAGCCTAA
GSTP1CCCTACACCGTGGTCTATTTCCGAGGCTTTGAGTGAGCCCT
NQO1TGAAGGACCCTGCGAACTTTCGAACACTCGCTCAAACCAGC
AKR1C1CAATTCCCATCGACCAGAGTTACTTGAGCCCTGGCTTGTT
UGDHGATGGGCTCCACAATGAACTTGGGCAACAGTGAGACTCTG
ThioredoxinCAACCCTTTCTTTCATTCCCTCTCACCCACCTTTTGTCCCTTCT