Table 1.

Sequences of PCR primers and reaction condition

PrimersSequences (5′-3′)No. cyclesAnnealing temperature (°C)Length of PCR products (bp)
ARF forwardTTCTTGGTGACCCTCCGGATT3553150
ARF reverseTGCCCATCATCATGACCTGG
INK4a forwardGGAGCAGCATGGAGCCTT3553197
INK4a reverseTGCCCATCATCATGACCTGG
β-actin forwardCAAGAGATGGCCACGGCTGCT2855257
β-actin reverseTCCTTCTGCATCCTGTCGGCA