Table 2.

Primers sequences of eight systematically searched DPYD gene SNPs in the study

DPYD SNPsSequencing primersTm
IVS1 + 1G AAGGCTGACTTTCCAGA48
−1590T>CATTTGCAAAGGTAAGATACT49.1
2846A>TGCAAGTTGTGGCTATGA50.4
85T>CCAAACTCATGCAACTCTG51.4
1156G>TTGCTAAGGAAGAAAAGTGT50.2
2657G>ATTGGACCTTATCTGGAA47.9
2983G>TGCTGTACTCTGTGTCTCAGT57.3
295-298 del TCATCCAACTAATCTTGATATTAA47.1