Table 1.

Target sequences of proteins investigated

Target geneGenbank accession #Target sequence
PKRNM002759699AACAACGAAUUCUUCAGAAGG719
RNase LNM0211331585AAGAACUACACUUGUCCUGUG1605
IFNAR1NM0006291529AACAGCCAUUGAAGAAUCUUC1549
TLR3U88879232AACAGUGUUGAACCUUACCCA252
IRF3BC000660408AACCGCAAAGAAGGGUUGCGU428
GL3U47296434CUUACGCUGAGUACUUCGA454