Table 1.

Sequences of primer pairs used to assess mRNA expression using RT-PCR

GeneSense primer (5′-3′)Antisense primer (5′-3′)Product (bp)
RARαGTCTGTCAGGACAAGTCCTCAGGGCTTTGCGCACCTTCTCAATGAG314
RARβ2GACTGTATGGATGTTCTGTCAGATTTGTCCTGGCAGACGAAGC255
RARγAATGACAAGTCCTCTGGCTACCACCAGATCCAGCTGCACGCGGTGGTC394
β-actinGCTCGTCGTCGACAACGGCTCGTACATGGCTGGGGTGTTGAAGG379
  • NOTE: The identity the product of each primer pair was confirmed by automated DNA sequencing.