Table 1.

Sequences of phosphorothioate oligonucleotides used

Note: Asterisk refers to 5-methyl-deoxycytidine.

OligomerLengthSequence 5′-3′a
Comments
G313918TCTCCCAGCGTGCGCCATTwo CpG motifs targeted to bcl-2 initiation codon
G421618TCTCCCAGCATGTGCCATG3139 variant with single base mismatch at each CpG motif
200920AATCCTCCCCCAGTTCACCCNo CpG motifs targeted to bcl-2 coding region
200624TCGTCGTTTTGTCGTTTTGTCGTTTriple-tandem repeat optimized human CpG sequences
G423218TCTCCCAGCGTGCGCCATG3139 variant with cytosine C5 methyl at each CpG motif
G426318TCCCTCAGCGTGCGCCATG3139 variant with two mismatches neither in CpG motifs
G426418ACCCTCAGCGGTGCGCCACG3139 variant with four mismatches, none in CpG motifs
G427318ATCCTAAGCGTGCGCCTTG3139 variant with six mismatches, none in CpG motifs
G427418CTCTATAGCGTGCGCCAG3139 variant with eight mismatches, none in CpG motifs
G427518CTCTATGACGTGCGTACAG3139 variant with 12 mismatches, none in CpG motifs
8482218TCTCCCAGCGTGCGCCATG3139 variant with cytosine C5 methyl in the 5′ CpG motif
8482318TCTCCCAGCGTGCGCCATG3139 variant with cytosine C5 methyl in the 3′ CpG motif
8482518TCTCCCAGCGTGCGCCATG3139 variant with cytosine C5 methyl not present at either CpG motif
  • a Bold italics represent mismatched bases.