Table 2

Sequences of primers used for amplification and sequencing of class I β-tubulin exons in humans and apes

ExonSpeciesaPrimerbLength of sequence (bp)c
Forward (5′–3′)Reverse (5′–3′)CodingNoncodingTotal
1H, C, GTCTCCCTCTCAGAACCTTCCTGGATAGCGGGTGCAAATG57214271
1OTCCAACCTTCCAGCCTGCGCAAATGCCCCACAACCA57142199
2H, C, GGGTTGCAGTGAGCCGAGAGGAAGGTTTATAGATATACTGGAAAT109346455
2OAAAGATGAAATAAAATGGTAGTTGGCAGCAGGGATCAGAGACTTGTC109232341
3H, C, G, OCTTCCCTTCTGCCAGATTTCGGTATGGAAGATACATGATGTTTC111278389
4AH, C, G, OGAAACATCATGTATCTTCCATACCAGGCATAAAGAAATGGAGACG50635541
4BH, C, G, OGTCACCACCTGCCTCCGTTGGGCACCAGAAAGAAATACAGG552d190742d
TotalH, C, G133510632398
TotalO13358772212
  • a H, human; C, chimpanzee; G, gorilla; O, orangutan.

  • b Primers were designed using clone m40 sequence (GenBank accession number J00314).

  • c Actual length of sequence varies from clone m40 because differences in sequence between human genomic DNA and clone.

  • d This excludes an overlapping sequence with exon 4a.