Article Figures & Data
Figures
- Figure 1.
Effects of DAC (0.1 μmol/L) for 4 d on MDA-MB-468 cells expressing hypomethylated INK4a/ARF. A, effects on protein and phosphoprotein expression. Control MDA-MB-468 cells (lane 1) were treated for 4 d with 0.1% DMSO (lane 2) or 0.1 μmol/L DAC (lane 3) and then Western-blotted using antibodies to the proteins (left). p-cdc2, phospho-cdc2 (see Materials and Methods). B, effects on growth. MDA-MB-468 cells were grown (column 1) and treated with either 0.1% DMSO (column 2) or 0.1 μmol/L DAC (column 3). After 4 d, the percentage of flow cytometric G2-M-arrested cells (top), apoptotic cells (middle), or growth-inhibited cells (bottom) was measured as detailed in Materials and Methods. SEs are based on triplicate samples.
- Figure 2.
Failure of p14/ARF and p16/INK4a knockdown to abrogate DAC-dependent growth inhibition in MDA-MB-468 cells expressing hypomethylated INK4a/ARF. A, Western blot confirmation of p16 and p14 knockdown efficiency. B, densitometric quantitation of p14 and p16 protein expression (Western blot) levels in negative control (NC, left columns) and experimental (siRNA, right columns) ARF and INK4a knockdowns, respectively. C, dose-dependent DAC growth inhibition of MDA-MB-468 cells with scrambled siRNA, INK4a siRNA, or ARF siRNA. Open diamonds, cells treated with scrambled siRNA; open squares, cells with knockdown of p14/ARF; filled triangles, cells with knockdown of p16/INK4a.
- Figure 3.
DAC inducibility of ARF (top row) and INK4a (middle row) mRNA expression in DLD-1 cells with hypermethylated INK4a/ARF. DLD-1 cells were treated with varying concentrations of DAC for 1 to 4 d, and total RNA was extracted for semiquantitative reverse-transcription PCR. β-Actin mRNA expression is shown as internal standard (bottom row). MDA-MB-468 cells expressing hypomethylated INK4a/ARF are included as a positive control (far right).
- Figure 4.
Growth effects of constitutive p14/ARF or p16/INK4a expression in transfected DLD-1 cells with hypermethylated INK4a/ARF promoters. A, Western blot confirmation of expression of p14 (left) and p16 (right). DLD-1 cells were stably transfected with vectors pWZL-hygro, pWZL-hygro-p14, pBabe-puro-EGFP, and pBabe-puro-p16 as described in Materials and Methods. B, growth effects of constitutive p14/ARF expression in transfected DLD-1 cells. Cell number was assayed by MTT after seeding for 1, 3, or 5 days. Open squares, DLD-1 with stable transfection of pWZL-hygro-p14; solid diamonds, DLD-1 with stable transfection of control vector pWZL-hygro. C, growth effects of constitutive p16/INK4a expression in transfected DLD-1 cells. Cell number was assayed by MTT after seeding for 1, 3, or 5 d. Open squares, DLD-1 with stable transfection of pBabe-puro-p16; solid diamonds, DLD-1 with stable transfection of control vector pBabe-puro-EGFP.
- Figure 5.
Comparative DAC dose-response of DLD-1 INK4a/ARF parameters (top) and growth (bottom). No treatment and DMSO controls, and DAC concentrations (0.01-10 μmol/L for 4 d), are indicated (bottom). MSP was used as described in Materials and Methods to measure genomic promoter DNA in either unmethylated (ARF, p14U, row 1; INK4a, p16U, row 3) or methylated (ARF, p14M, row 2; INK4a, p16M, row 4) genes. Western blotting was used to quantify dose-dependent p14 (row 5), p16 (row 6), or control β-actin protein expression (row 7). The percentage of cells recruited into flow cytometric S-phase arrest (top), apoptosis (middle), or growth inhibition (bottom) was measured as detailed in Materials and Methods. SEs are based on triplicate samples.
Tables
- Table 1.
Sequences of PCR primers and reaction condition
Primers Sequences (5′-3′) No. cycles Annealing temperature (°C) Length of PCR products (bp) ARF forward TTCTTGGTGACCCTCCGGATT 35 53 150 ARF reverse TGCCCATCATCATGACCTGG INK4a forward GGAGCAGCATGGAGCCTT 35 53 197 INK4a reverse TGCCCATCATCATGACCTGG β-actin forward CAAGAGATGGCCACGGCTGCT 28 55 257 β-actin reverse TCCTTCTGCATCCTGTCGGCA
Volume 8, Issue 4
