Article Figures & Data
Figures
- Figure 1.
Verticillin A induces apoptosis in HGSOC cell lines in vitro. A, OVSAHO, OVCAR4, and OVCAR8 cells were treated with vehicle (DMSO), verticillin A (50 nmol/L), and chemotherapeutic control taxol (10 nmol/L) for 72 hours. Dose–response curves were generated and normalized to vehicle control. IC50 values are denoted in the table. B, OVCAR4 and OVCAR8 cells were treated with vehicle and verticillin A (50 nmol/L) for 8 hours. Following drug incubation, media was changed and cells were incubated for 2 weeks to form colonies. Representative images of 2D foci assay performed in OVCAR4 and OVCAR8 cells are shown. Each experiment was performed in three biological replicates, and data represent mean ± SEM. Significance tested by Student t test in comparison to vehicle control. C, OVCAR8 spheroids were treated with vehicle, verticillin A, taxol, and cisplatin for 72 hours. Spheroid viability was determined using CellTiter-Glo Cell Viability assay. IC50 values are denoted in the table. Data represent mean ± SEM from two biological replicates.
- Figure 2.
RNA-sequencing analysis shows upregulation of apoptosis and oxidative stress in verticillin A–treated OVCAR8 cells. A, OVCAR4 and OVCAR8 cells were treated with vehicle (DMSO), verticillin A (50 nmol/L), and taxol (10 nmol/L) for 24 hours, stained with Annexin V-FITC and propidium iodide, and analyzed by Nexcelom Cellometer. Each experiment was performed in three biological replicates, and data represent mean ± SEM. Statistics were generated with one-way ANOVA with Dunnett multiple comparisons with vehicle control within each group. B, Immunoblot analysis of whole-cell lysates of OVCAR4 and OVCAR8 cells probed for apoptotic marker (cPARP), and actin was used as a loading control. C, OVCAR8 cells were treated with vehicle and verticillin A for 24 hours. Chart denotes pathway analysis of the upregulated genes by PANTHER analysis. D, Table represents pathways identified by GSEA for OVCAR8 cells treated with vehicle control and verticillin A. E, Gene set enrichment plots based upon GSEA of transcripts altered by verticillin A treatment in OVCAR8 cells.
- Figure 3.
Verticillin A causes oxidative stress and DNA damage in HGSOC cells. A, Verticillin A–induced oxidative stress in OVCAR4 and OVCAR8 cells was measured with CellROX Green reagent in cells treated with vehicle (DMSO), verticillin A (50 nmol/L for 6 hours), and H2O2 (50 μmol/L for 1 hour). Images were acquired using 40× objective of a fluorescent microscope. Scale bar, 20 μm. B, OVCAR4 and OVCAR8 cells were treated with vehicle, verticillin A (50 nmol/L), and H2O2 (50 μmol/L), and alkaline comet assay was performed to analyze DNA damage. Comet tail moment was used to quantify DNA damage by TriTek CometScore software. Each experiment was performed in three biological replicates, and data represent mean ± SEM. Statistics were generated with one-way ANOVA with Dunnett multiple comparisons with vehicle control within each cell line. Scale bar, 20 μm. C, Representative images of immunofluorescence staining of γH2A.X foci for OVCAR4 and OVCAR8 cells treated with vehicle and verticillin A (50 nmol/L) for 24 hours. Nuclei were stained by DAPI (0.1 μg/mL). Scale bar, 20 μm. D, Immunoblot analysis of whole-cell lysates of OVCAR4 and OVCAR8 cells treated with vehicle and verticillin A (50 nmol/L) for different timepoints. Lysates were probed for DNA damage marker γH2A.X, and actin was used as a loading control.
- Figure 4.
Verticillin A–mediated apoptosis and DNA damage are reversed by free radical quencher NAC. A, Immunoblot analysis of whole-cell lysates of OVCAR4 and OVCAR8 cells treated with vehicle (DMSO), verticillin A (50 nmol/L), and combination of verticillin A (50 nmol/L) and NAC (1 mmol/L) for 24 hours. Lysates were probed for apoptosis and DNA damage markers. Actin was used as a loading control. B, OVCAR4 and OVCAR8 cells were treated with vehicle, verticillin A (50 nmol/L), and combination of verticillin A (50 nmol/L) and NAC (1 mmol/L) for 24 hours, stained with Annexin V-FITC (AV) and propidium iodide (PI), and analyzed by Nexcelom Cellometer. Each experiment was performed in three biological replicates, and data represent mean ± SEM. Statistics were generated with one-way ANOVA with Tukey multiple comparisons within each group. C, OVCAR4 and OVCAR8 cells were treated with vehicle, verticillin A (50 nmol/L), and combination of verticillin A (50 nmol/L) and NAC (1 mmol/L) for 24 hours. Alkaline comet assay was performed to analyze DNA damage. Comet tail moment was used to quantify DNA damage by TriTek CometScore software. Each experiment was performed in three biological replicates, and data represent mean ± SEM. Statistics were generated with one-way ANOVA with Tukey multiple comparisons within each cell line. Scale bar, 20 μm; ns, not significant.
- Figure 5.
eNP-VA demonstrate reduced liver toxicity relative to free drug. A, OVCAR8-RFP cells were xenografted intraperitoneally to form tumors. Mice were dosed with verticillin A and vehicle (Cremophor EL/EtOH) once in 7 days (dosage: 0.5 mg/kg). Representative images show liver damage in verticillin A–treated animals. B, Four ovarian cell lines (IOSE80, FT33, OVCAR4, and OVCAR8) were treated with vehicle (DMSO) and verticillin A (50 nmol/L) for 72 hours. Dose–response curves were generated and normalized to vehicle control. Each experiment was performed in three biological replicates, and data represent mean ± SEM. Statistics were generated with Student t test for day 0 and day 3 within each cell line. C, OVSAHO, OVCAR4, and OVCAR8 cells were treated with eNP-VA and empty nanoparticles (eNP) for 72 hours. Dose–response curves were generated and normalized to eNP. Data represent mean ± SEM from three biological replicates. IC50 values are denoted in the table.
- Figure 6.
Verticillin A reduces tumor burden in vivo. A, OVCAR8-RFP cells were xenografted intraperitoneally to form tumors. Mice were dosed with eNP-VA and eNP once every 2 days for total 12 days (dosage: 0.5 mg/kg). Representative images show IVIS images of tumors in mice on days 0, 4, 8, and 12 of drug treatment. B, Quantification of tumor burden (average radiant efficiency as measured with IVIS imaging) normalized to day 0. Statistics were performed using two-way ANOVA relative to vehicle control. C, Quantification of average body weight (BW) of the mice during the course of treatment with eNP and eNP-VA. D, H & E staining showing the histomorphology of paraffin-embedded tumor tissue sections of eNP and eNP-VA–treated animals. E, IHC of γH2A.X and cPARP staining as markers of DNA damage and apoptosis is shown from tumors of animals treated with eNP and eNP-VA. Scale bar, 20 μm.
Tables
- Table 1.
qRT-PCR primers.
Target gene Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′) TXN TGAAGCAGATCGAGAGCAAGAC TTCATTAATGGRGGCRRCAAGC DUSP6 CCTGAGGCCATTTCTTTCATAGA GTCACAGTGACTGAGCGGCTAAT NFKB2 GAACAGCCTTGCATCTAGCC TCCCAGTCGCTATCAGAGG RELB TCCCAACCAGGATGTCTAGC AGCCATGTCCCTTTTCCTCT TXNRD1 GAAGATCTTCCCAAGTCCTATGAC ATTTGTTGCCTTAATCCTGTGAGG - Table 2.
Primary antibodies.
Antibody Source Dilution for WB Dilution for immunofluorescence/IHC Anti-rabbit PARP CST #9542 1:1,000 — Anti-rabbit cPARP CST #9541 — 1:100 (IHC) Anti-rabbit γH2A.X CST #9718 1:500 1:100 (IHC, IF) Anti-rabbit Bax CST #5023 1:500 — Anti-rabbit actin Sigma #A2066 1:5,000 — Abbreviations: CST, Cell Signaling Technology; IF, immunofluorescence; WB, Western blotting.
- Table 3.
Secondary antibodies.
Antibody Source Dilution for WB Dilution for immunofluorescence Anti-rabbit IgG-HRP CST #7074 1:10,000 — Anti-rabbit Alexa Fluor 488 Invitrogen #A-11034 — 1:1,000 Abbreviations: CST, Cell Signaling Technology; WB, Western blotting.
Volume 19, Issue 1
