Advertisement
Cancer Biology and Signal Transduction

Inhibition of HSP90 by AUY922 Preferentially Kills Mutant KRAS Colon Cancer Cells by Activating Bim through ER Stress

Chun Yan Wang, Su Tang Guo, Jia Yu Wang, Fen Liu, Yuan Yuan Zhang, Hamed Yari, Xu Guang Yan, Lei Jin, Xu Dong Zhang and Chen Chen Jiang
DOI: 10.1158/1535-7163.MCT-15-0778 Published March 2016

Abstract

Oncogenic mutations of KRAS pose a great challenge in the treatment of colorectal cancer. Here we report that mutant KRAS colon cancer cells are nevertheless more susceptible to apoptosis induced by the HSP90 inhibitor AUY922 than those carrying wild-type KRAS. Although AUY922 inhibited HSP90 activity with comparable potency in colon cancer cells irrespective of their KRAS mutational statuses, those with mutant KRAS were markedly more sensitive to AUY922-induced apoptosis. This was associated with upregulation of the BH3-only proteins Bim, Bik, and PUMA. However, only Bim appeared essential, in that knockdown of Bim abolished, whereas knockdown of Bik or PUMA only moderately attenuated apoptosis induced by AUY922. Mechanistic investigations revealed that endoplasmic reticulum (ER) stress was responsible for AUY922-induced upregulation of Bim, which was inhibited by a chemical chaperone or overexpression of GRP78. Conversely, siRNA knockdown of GRP78 or XBP-1 enhanced AUY922-induced apoptosis. Remarkably, AUY922 inhibited the growth of mutant KRAS colon cancer xenografts through activation of Bim that was similarly associated with ER stress. Taken together, these results suggest that AUY922 is a promising drug in the treatment of mutant KRAS colon cancers, and the agents that enhance the apoptosis-inducing potential of Bim may be useful to improve the therapeutic efficacy. Mol Cancer Ther; 15(3); 448–59. ©2016 AACR.

This article is featured in Highlights of This Issue, p. 345

Introduction

Colon cancer is one of the most common and deadly malignancies (1). Despite recent advances in early diagnosis and the development of molecularly targeted therapy, the overall survival of patients with metastatic colon cancers remains disappointing (1). This is often associated with resistance of colon cancer cells to systemic therapies resulting from oncogenic mutations of KRAS which drive activation of multiple signaling pathways important for cell survival and proliferation (2). In fact, activating mutations of KRAS are found in up to 50% of colon cancers that forecast inherited resistance to antibodies against the EGFR (2, 3).

HSP90 is the most abundant molecular chaperone and is essential for folding, stabilization, and activation of a large number of proteins (4). In particular, many mutant and overexpressed oncoproteins such as EGFR, mutant BRAF, and Akt are clients of HSP90 (4). As such, targeting HSP90 appears a promising approach in the treatment of cancer (4). Intriguingly, mutant KRAS-driven cancer cells have been noted to be sensitive to HSP90 inhibition (5–7), but the molecular mechanisms involved remain poorly understood. Nevertheless, multiple HSP90 inhibitors are currently in clinical studies for the treatment of cancer (4).

Induction of apoptosis is a common mechanism by which therapeutic drugs kill cancer cells (8). This is frequently mediated by activation of the mitochondrial apoptotic pathway, which is regulated by the balance between proapoptotic and antiapoptotic Bcl-2 family proteins (8). Of note, multiple Bcl-2 family proteins are responsive to inhibition of HSP90 in a cell-type and context-dependent manner (9–12). In particular, p53-dependent induction of the BH3-only protein PUMA has been shown to be responsible for apoptosis of colon cancer cells induced by the HSP90 inhibitor 17-AAG (10). Moreover, the antiapoptotic Bcl-2 family proteins, Bcl-2, Mcl-1, and Bcl-XL, have all been reported to protect cells against HSP90 inhibition–induced apoptosis (9, 11–13).

Another frequently observed consequence of HSP90 inhibition is endoplasmic reticulum (ER) stress, which is characterized by accumulation of unfolded and/or misfolded proteins in the ER lumen. The ER responds to ER stress by activation of a range of signaling pathways, collectively called the ER stress response or the unfolded protein response (UPR; refs. 14, 15). The UPR is initiated by three ER transmembrane proteins, activating transcription factor 6 (ATF6), inositol-requiring enzyme 1 (IRE1), and double-stranded RNA-activated protein kinase-like ER kinase (PERK), and is essentially a cellular protective response. However, excessive UPR kills cells primarily by induction of apoptosis (14–16). Multiple mechanisms such as activation of the BH3-only proteins Bim, PUMA, and Noxa, and downregulation of antiapoptotic Bcl-2 family proteins including Bcl-2 and Mcl-1 have been implicated in ER stress–induced apoptosis (17–19).

We have examined the potency of the HSP90 inhibitor AUY922 in colon cancer cells with different mutational statuses of KRAS. We show here that AUY922 preferentially induces apoptosis in mutant compared with wild-type KRAS colon cancer cells, and that activation of Bim through ER stress is responsible for apoptosis triggered by AUY922. In addition, we demonstrate that AUY922 inhibits the growth of mutant KRAS colon cancer xenografts similarly through Bim-mediated apoptosis that is associated with ER stress.

Materials and Methods

Cell culture

Human colon cancer cell lines provided by Prof. Gordon Burns (Faculty of Health and Medicine, University of Newcastle, New South Wales, Australia) were described previously (20). The normal human colon epithelial cell line FHC (ATCC CRL-1831) was from ATCC, and cultured as described previously (20). Individual cell line authentication was regularly confirmed every 6 months using the AmpFISTR Identifier PCR Amplification Kit from Applied Biosystems and GeneMarker V1.91 software (SoftGenetics LLC). The last test was done in May 2015.

Three-dimensional culture

Three-dimensional (3D) culture was performed using the hanging drop technique as described previously (21). Briefly, 500 cells were seeded into the Perfecta3D hanging drop plate (3D Biomatrix), and monitored with the Axiovert and Axioplan microscope (Carl Zeiss) for at least 5 days. Cells were then stained with calcein AM and ethidium homodimer-1 (Life Technologies) for 24 hours followed by treatment. Spheroids were harvested onto slides and examined with a fluorescence microscope (Carl Zeiss).

Antibodies and reagents

Antibodies and reagents used are listed in Supplementary Tables S1 and S2.

Quantitative real-time PCR

qPCR was performed as described previously (17). The relative abundance of target mRNA in control group was arbitrarily designated as 1. The primes are forward primers for Bim (GCCCCTACCTCCCTACAGAC), Bcl-2 (CTGCACCTGACGCCCTTCACC), spliced XBP-1 (GCACCTGAGCCCCGAGGAGA), XBP-1 (AGCCAAGGGGAATGAAGTGAG), or β-actin (GGCACCCAGCACAATGAAG); reverse primers for Bim (ATGGTGGTGGCCATACAAAT), Bcl-2 (CACATGACCCCACCGAACTCAAAGA). Spliced XBP-1 (TCATTCCCCTTGGCTTCCGCC), XBP-1 (CTGCAGAGGTGCACGTAGTC), or β-actin (GCCGATCCACACGGAGTACT).

Plasmid vector and transfection

The pCMV6-AC-GFP-Bcl-2 vector was from Origene (Australian Biosearch). GRP78 cDNA cloned into pcDNA3.1 was provided by Dr. Richard C. Austin (McMaster University and the Hamilton Civic Hospitals Research Centre, Hamilton, Ontario, Canada) and described elsewhere (22).

siRNA and shRNA

siRNA constructs are listed in Supplementary Table S3. siRNA transfection was carried out as described previously (17). MISSION human short hairpin RNA (shRNA) lentiviral transduction particles Bim (SHCLNV-NM_009754) and the control particles were from Sigma-Aldrich.

Colon cancer xenograft mouse model

Colon cancer cells were injected subcutaneously into flanks of male athymic nude mice (Model Animal Research Centre of Nanjing University, China). Ten days after injection, when xenografts were approximately 100 mm3, mice were randomly assigned into different groups (n = 8). Mice were treated daily with AUY922 (50 mg/kg/day in sterile PBS via i.p. injection), or equivalent volumes of the vehicle (DMSO) for 10 days. Mice were examined as described previously and sacrificed at 28 days after tumor cell transplantation (23). Studies on animals were approved by the Animal Research Ethics Committee of Shanxi Cancer Hospital, China.

Statistical analysis and data presentation

Statistical analysis was performed using JMP Statistics Made Visual software. Student t test was used to assess differences between different groups. A P value less than 0.05 was considered statistically significant.

Results

Mutant KRAS colon cancer cells are more susceptible to killing by AUY922

HCT116 (KRASG13D), SW620 (KRASG12V), and WiDr and Caco-2 (wild-type KRAS) cells were treated with AUY922 at increasing concentrations for 48 hours. Strikingly, HCT116 and SW620 cells appeared more sensitive than WiDr and Caco-2 cells to AUY922-induced reduction in viability as measured using CellTiter-Glo assays (Fig. 1A), with the half-maximum inhibitory concentration (IC50) values ranging from 76.5 to 82.2 nmol/L in HCT116 and SW620 cells, respectively, to >400 nmol/L in WiDr and Caco-2 cells (Fig. 1A and B). Of importance, AUY922 did not significantly affect survival of normal colon epithelial cells even when used at 400 nmol/L (Supplementary Fig. S1).

Figure 1.
Figure 1.

Mutant KRAS colon cancer cells are more sensitive to killing by AUY922. A, colon cancer cells were treated with AUY922 for 48 hours. Cell viability was quantitated using CellTiter-Glo assays. Data are mean ± SE, n = 3. **, P < 0.01; *, P < 0.05, Student t test. B, comparison of IC50 of AUY922 in colon cancer cell lines treated with the inhibitor for 48 hours. Data are mean ± SE, n = 3. C, cells seeded at 2,000 cells/well onto 6-well plates were treated with AUY922 (80 nmol/L; left). Twelve days later, cells were stained crystal violet. Scale bar, 1 cm. Right, quantitation of results of clonogenic assays as shown in the left panel. Data are representative (left) or mean ± SE (right), n = 3. *, P < 0.05, Student t test. D, five hundred cells were seeded into a 96-well Perfecta3D hanging drop plate. Five days later, cells were stained with calcein AM and ethidium homodimer-1 for 24 hours followed by treatment with AUY922 (80 nmol/L) for 48 hours. Data are representative, n = 3. Scale bars, 25 μm. E, whole cell lysates were subjected to Western blot analysis. Data are representative, n = 3. F, cells transfected with the control or HSP90 siRNAs were subjected to CellTiter-Glo assays (top) or Western blot analysis (bottom). Data shown are either representative (bottom) or mean ± SE (top), n = 3. **, P < 0.01, Student t test.

The different responses of the colon cancer cells to AUY922 were also reflected in clonogenic assays and in cells grown in 3D cultures when the inhibitor was used at 80 nmol/L (the approximate IC50 value in HCT116 and SW620 cells; Fig. 1C and D). Nevertheless, AUY922 at this concentration inhibited HSP90 activity similarly in sensitive and resistant cells, as it induced comparable degrees of downregulation of the HSP90 clients CRAF and S-phase kinase-associated protein 2 (SKP2), and upregulation of HSP70 (Fig. 1E). Consistent with previous findings (24), AUY922 inhibited activation of ERK and Akt, which are downstream of multiple clients of HSP90, in colon cancer cells irrespective of their KRAS mutational status (Fig. 1E).

The increased susceptibility of mutant KRAS colon cancer cells to AUY922 was confirmed in additional two mutant KRAS cell lines [SW480 (KRASG12V) and EB (KRASG12D)] and three wild-type KRAS colon cancer lines (Colo205, Lim1863, and Lim1215; Fig. 1B). Of note, sensitivity of colon cancer cells to AUY922 was not associated with the expression levels of HSP90 (Supplementary Fig. S2). Nevertheless, knockdown of HSP90α and β, two major isoforms of HSP90 that are inhibited by AUY922 (25, 26), similarly inhibited survival of HCT116 and SW620 but not WiDr and Caco-2 cells (Fig. 1F). Collectively, these results indicate that, in contrast to resistance to many therapeutic drugs (2, 3), mutant KRAS colon cancer cells are vulnerable to HSP90 inhibition.

Killing of mutant KRAS colon cancer cells by AUY922 is associated with upregulation of Bim, Bik, and PUMA

The general caspase inhibitor z-VAD-fmk efficiently inhibited AUY922-induced HCT116 and SW620 cell death, indicating that AUY922 kills these cells by apoptosis (Fig. 2A and Supplementary Fig. S3; ref. 27). In support, AUY922 caused accumulation of sub-G1 DNA content, exposure of phosphatidylserine onto the cell surface, activation of caspase-3, and cleavage of its substrate PARP (Fig. 2B and Supplementary Fig. S4). Overexpression of Bcl-2 inhibited apoptosis induced by AUY922 (Fig. 2C), indicating that the mitochondrial apoptotic pathway plays an essential role. Consistently, knockdown of Bax also diminished apoptosis induced by AUY922 (Fig. 2D; ref. 10). Moreover, AUY922 triggered reduction in the mitochondrial membrane potential, release of cytochrome c and Smac/DIABLO, and activation of caspase-9 in HCT116 and SW620 cells (Fig. 2B and Supplementary Fig. S5).

Figure 2.
Figure 2.

AUY922 upregulates Bim, Bik, and PUMA in mutant colon cancer cells. A, cells were treated with z-VAD-fmk (30 μmol/L) for 1 hour before adding AUY922 (80 nmol/L) for 48 hours. Cell viability was quantitated by CellTiter-Glo assays. Data are mean ± SE, n = 3. **, P < 0.01, Student t test. B, whole cell lysates from cells treated with AUY922 (80 nmol/L) for 48 hours were subjected to Western blot analysis. Data are representative, n = 3. C, whole cell lysates from cells transiently transfected with the vector alone or Bcl-2 cDNA were subjected to Western blot analysis (top). Cells transiently transfected with the vector alone or Bcl-2 cDNA were treated with AUY922 (80 nmol/L) for 48 hours before measurement of apoptosis by the propidium iodide (PI) method (bottom). Data are representative (top) or mean ± SE (bottom), n = 3. *, P < 0.05, Student t test. D, whole cell lysates from cells transfected with the control or Bax siRNAs were subjected to Western blot analysis (top). Cells transiently transfected with the control or Bax siRNAs were treated with AUY922 (80 nmol/L) for 48 hours (bottom). Apoptosis was measured of by the PI method. Data are representative (top) or mean ± SE (bottom), n = 3. *, P < 0.05, Student t test. E, whole cell lysates from cells treated with AUY922 (80 nmol/L) for the indicated periods were subjected to Western blot analysis. Data are representative, n = 3.

As a client protein of HSP90, Bcl-2 was reduced rapidly in HCT116 and SW620 cells, but not in wild-type KRAS colon cancer cells, upon treatment with AUY922 (Fig. 2E; refs. 9, 28). On the other hand, the expression of the other antiapoptosis Bcl-2 family proteins, Mcl-1 and Bcl-XL, was not changed by AUY922 even in HCT116 and SW620 cells (Fig. 2E). Remarkably, AUY922 upregulated multiple BH3-only proteins, including Bim, Bik, and PUMA in sensitive but not in resistant colon cancer cells (Fig. 2E). There was no change in the expression of Bax and Bak, nor was there any alteration in phosphorylation (deactivation) of the BH3-only protein Bad, upon AUY922 treatment in both mutant and wild-type KRAS colon cancer cells (Fig. 2E).

Bim plays an essential role in apoptosis of mutant KRAS colon cancer cells induced by AUY922

We knocked down Bim, Bik, and PUMA using two individual siRNAs in HCT116 and SW620 cells (Fig. 3A–C). Strikingly, knockdown of Bim abolished cell death induced by AUY922 (Fig. 3D), whereas knockdown of Bik also inhibited, albeit partially, AUY922-induced cell death (Fig. 3D). Consistent with the lack of upregulation of Bim in wild-type KRAS colon cancer cells by AUY922 (Fig. 2E), knockdown of Bim did not alter sensitivity of Caco-2 cells to AUY922 (Supplementary Fig. S6). Of interest, although PUMA and p53 have been reported to mediate killing of colon cancer cells by the other HSP90 inhibitor 17-AAG (10), knockdown of PUMA or p53 did not impinge on killing of HCT116 and SW620 cells by AUY922 (Fig. 3C and D and Supplementary Fig. S7). Nevertheless, PUMA or p53 knockdown inhibited cell death induced by the MDM2 inhibitor nutlin-3 (Supplementary Fig. S7; ref. 29), verifying the functional efficacy of the PUMA and p53 siRNAs.

Figure 3.
Figure 3.

Bim is essential for AUY922-induced apoptosis in mutant KRAS colon cancer cells. A–C, whole cell lysates from cells transfected with the control or Bim (A), Bik (B), or PUMA (C) siRNAs were subjected to Western blot analysis. Data are representative, n = 3. D, HCT116 (top) and SW620 (bottom) cells transfected with the control or Bim, Bik, or PUMA siRNAs were treated with AUY922 (80 nmol/L) for 48 hours. Apoptosis was measured by the PI method. Data are mean ± SE, n = 3. *, P < 0.05, Student t test.

AUY922-triggered ER stress is responsible for upregulation of Bim in mutant KRAS colon cancer cells

Upregulation of Bim by AUY922 was associated with elevation in its mRNA levels (Supplementary Fig. S8A). This was due to a transcriptional increase rather than changes in its stability as shown in actinomycin D–chasing assays (Supplementary Fig. S8B and S8C; ref. 17). As Bim transcription is responsive to ER stress (19), we tested whether ER stress was involved in upregulation of Bim by AUY922. Indeed, treatment with AUY922 activated the ER stress response in mutant but not wild-type KRAS colon cancer cells (Fig. 4A and B). Noticeably, the expressions of IRE1 and PERK that have been reported to be HSP90 clients remain unchanged after treatment with AUY922 (Fig. 4A).

Figure 4.
Figure 4.

ER stress is responsible for upregulation of Bim by AUY922 in mutant KRAS colon cancer cells. A, whole cell lysates were subjected to Western blot analysis. Data are representative, n = 3. B, total RNA from cells treated with AUY922 (80 nmol/L) was subjected for qPCR analysis of spliced XBP-1 (left) or native XBP-1 (right) mRNA. Data are mean ± SE, n = 3. **, P < 0.01; *, P < 0.05, Student t test. C, whole cell lysates from cells transfected with the control or CHOP siRNAs were subjected to Western blot analysis (top). HCT116 (middle) and SW620 (bottom) cells transfected with the control or CHOP siRNAs with or without treatment with AUY922 (80 nmol/L) for 48 hours were subjected to qPCR analysis. Data are representative (top) or mean ± SE (middle and bottom), n = 3. **, P < 0.01, Student t test. D, HCT116 and SW620 cells were treated with BGP-15 (10 μmol/L) or 4-PBA (1 mmol/L) for 1 hour before the addition of AUY922 (80 nmol/L) for further 48 hours. Apoptosis was measured by the PI method. Data are mean ± SE, n = 3. *, P < 0.05, Student t test. E, whole cell lysates from cells treated with AUY922 (80 nmol/L) for 48 hours in the presence or absence of BGP-15 (10 μmol/L) or 4-PBA (1 mmol/L) were subjected to Western blot analysis. Data are representative, n = 3. F, whole cell lysates from cells transiently transfected with the vector alone or GRP78 cDNA were subjected to Western blot analysis (top). HCT116 and SW620 cells transiently transfected with the vector alone or GRP78 cDNA were subjected to measurement of apoptosis by the PI method using flow cytometry (bottom). Data are representative (top) or mean ± SE (bottom), n = 3. *, P < 0.05, Student t test.

As CCAAT-enhancer-binding protein homologous protein (CHOP) is responsible for transcriptional upregulation of Bim by ER stress (19), we examined the potential role of CHOP in Bim upregulation by AUY922 in colon cancer cells. As shown in Fig. 4C, siRNA knockdown of CHOP inhibited upregulation of Bim, activation of caspase-3, cleavage of PARP, and cell death induced by the inhibitor in HCT116 and SW620 cells (Supplementary Fig. S9). In support, the chemical chaperon BGP-15 or 4-PBA attenuated killing by AUY922 (Fig. 4D; refs. 30, 31). This was associated with reduced induction of GRP78, spliced XBP-1, CHOP, and Bim (Fig. 4E and Supplementary Fig. S10). Similarly, overexpression of GRP78 inhibited AUY922-induced upregulation of CHOP and Bim and apoptosis in HCT116 and SW620 cells (Fig. 4F and Supplementary Fig. S11).

Inhibition of GRP78 or XBP-1 enhances AUY922-induced killing in colon cancer cells

We examined whether inhibition of GRP78 and XBP-1, two major prosurvival effectors of the ER stress response (14, 15), affected sensitivity of colon cancer cells to AUY922. Knockdown of either GRP78 or XBP-1 increased apoptosis induced by AUY922 in HCT116 and SW620 cells (Fig. 5A–C). Of note, it also rendered WiDr cells sensitive, albeit moderately, to AUY922-induced killing (Fig. 5A–C), suggesting that resistance of wild-type KRAS colon cancer cells to AUY922 is, at least in part, due to better adaptation to ER stress. The effect of XBP-1 was further confirmed by treatment with salicylaldehyde that inhibits the IRE1 endonuclease activity thus blocking splicing (activation) of XBP-1 (Fig. 5D; ref. 32).

Figure 5.
Figure 5.

Knockdown of GRP78 or XBP-1 enhances AUY922-induced killing of colon cancer cells. A, whole cell lysates from cells transfected with the control, GRP78 (top), or XBP-1 (bottom) siRNAs were treated with AUY922 (80 nmol/L). Whole cell lysates were subjected to Western blot analysis. Data are representative, n = 3. B, total RNA from cells transfected with the control, GRP78, or XBP-1 siRNAs were subjected to qPCR analysis. Data are mean ± SE, n = 3. *, P < 0.05, Student t test. C, cells transfected with the control, GRP78, or XBP-1 siRNAs were treated with AUY922 (80 nmol/L) for 48 hours. Apoptosis was measured by the PI method. Data are mean ± SE, n = 3. *, P < 0.05, Student t test. D, total RNA from cells treated with AUY922 (80 nmol/L) for 48 hours in the presence or absence of salicylaldehyde (60 μmol/L) were subjected to qPCR analysis (top). Cells treated with AUY922 (80 nmol/L) for 48 hours in the presence or absence of salicylaldehyde (60 μmol/L) were subjected to the PI method (bottom). Data are mean ± SE, n = 3. *, P < 0.05, Student t test.

Deficiency in Bim blocks the inhibitory effect of AUY922 on mutant KRAS colon cancer xenograft growth

To test the effect of AUY922 on the growth of colon cancers in vivo, we transplanted HCT116 and WiDr cells into nu/nu mice. Administration of AUY922 inhibited established HCT116 tumor growth, but did not impinge on the growth of WiDr tumors (Fig. 6A–C). Inhibition of HCT116 tumor growth by AUY922 was associated with activation of caspase-3, upregulation of Bim, and induction of ER stress (Fig. 6D and E). However, the inhibitory effect was diminished in xenografts of HCT116 cells with Bim stably knocked down, although AUY922 triggered ER stress in the tumors (Fig. 6F–H).

Figure 6.
Figure 6.

Mutant KRAS colon cancer xenografts deficient in Bim are resistant to AUY922. A, representative photographs of xenografts of HCT116 and WiDr cells grown in flanks of nu/nu mice (n = 8) treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Mice were euthanized and tumors harvested at 28 days after the first treatment, n = 8. Scale bar, 5 mm. B, comparison of growth rates of xenografts of HCT116 (left) and WiDr (right) cells in flanks of nu/nu mice (n = 8) treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Data are mean ± SE, n = 8. *, P < 0.05, Student t test. C, comparison of weight of harvested xenografts of HCT116 and WiDr cells in flanks of nu/nu mice treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Data are mean ± SE, n = 8. **, P < 0.01, Student t test. D, crude whole cell lysates from xenografts of HCT116 cells in nu/nu mice treated with the vehicle control (DMSO) or AUY922 (50 mg/kg) were subjected to Western blot analysis. Data are representative, n = 3. E, total RNA from xenografts of HCT116 cells in nu/nu treated with the vehicle control (DMSO) or AUY922 (50 mg/kg) was subjected to qPCR analysis of spliced XBP-1 (top) or native XBP-1 (bottom) mRNA. Data are mean ± SE, n = 3. **, P < 0.01, Student t test. F, whole cell lysates from HCT116 cells stably transduced with the control shRNA (shControl) or Bim shRNA (shBim) were subjected to Western blot analysis. Data are representative, n = 3. G, representative photographs of xenografts of HCT116 stably transduced with shControl or shBim grown in flanks of nu/nu mice (n = 8) treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Mice were euthanized and tumors harvested at 28 days after the first treatment, n = 8. Scale bar, 5 mm. H, comparison of volume (top) or weight (bottom) of xenografts of HCT116 cells transduced with the control or Bim shRNA treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Data are mean ± SE, n = 8. **, P < 0.01, Student t test.

Discussion

We have shown in this study that mutant KRAS colon cancer cells are more susceptible to apoptosis induced by the HSP90 inhibitor AUY922, consistent with the observations in other types of cancers that HSP90 inhibition has the greatest effect in tumors addicted to particular driver oncogene products, such as HER2 in breast cancer (33), mutant EGFR or ALK translocations in non–small cell lung carcinoma (NSCLC; refs. 34, 35), and mutant BRAF in melanoma (36). In particular, inhibition of HSP90 has been shown to have potent antitumor activity in mutant KRAS NSCLC models in vivo (37, 38). Moreover, we have demonstrated that activation of Bim though ER stress plays an essential role in AUY922-induced apoptosis of mutant KRAS colon cancer cells (Supplementary Fig. S12).

Although HSP90 inhibition has diverse effects on cancer cells (4), AUY922 primarily induced caspase-dependent mitochondrion-mediated apoptosis in mutant KRAS colon cancer cells. This bears important implications, in that the ultimate goal of treatment of cancer is to eradicate cancer cells. While our results showing that knockdown of Bax blocked induction of cell death consolidated the importance of the mitochondrial apoptotic pathway in AUY922-triggered killing, Bax-deficient colon cancer cells have been shown to commit to necrosis upon treatment with the other HSP90 inhibitor 17-AAG (10, 13, 39). This difference may be due to the different HSP90 inhibitors used in the individual studies. Indeed, comparative analyses have shown that there are profound differences in biologic consequences of treatment of colon cancer cells with 17-AAG and AUY922 (40). In support, although p53 and PUMA are required for 17-AAG–induced apoptosis of colon cancer cells (10), they were indispensable for killing by AUY922. Regardless, our results clearly demonstrated that Bim, but not PUMA or the other BH3-only protein Bik, played a fundamental role in AUY922-induced apoptosis of KRAS-mutant colon cancer cells.

An important finding of this study was that mutant KRAS colon cancer cells were more prone to AUY922-induced ER stress. Although ER stress has been found previously to contribute to apoptosis induced by HSP90 inhibition (41), the role of ER stress–induced Bim has not been documented. Consistent with the previous finding that ER stress activates Bim transcription through CHOP (19), we found that knockdown of CHOP inhibited AUY922-triggered upregulation of Bim. Indeed, chemical chaperones or overexpression of GRP78, which alleviates ER stress (30), attenuated upregulation of CHOP and Bim by AUY922. On the other hand, siRNA inhibition of GRP78 or XBP-1, two well-established prosurvival effectors of the UPR (14, 15), enhanced upregulation of Bim and apoptosis caused by AUY922. It seems therefore that other agents that induce ER stress may cooperate with HSP90 inhibition to induce apoptosis in mutant KRAS colon cancer cells. In support with our findings in mutant KRAS colon cancer, deletion of CHOP in a mouse model of mutant KRAS-induced lung cancer increases tumor incidence, suggesting that CHOP activity is a barrier to mutant KRAS-driven malignancy (42).

As a HSP90 client protein (9), Bcl-2 is reduced, as anticipated, by AUY922. However, this was observed only in mutant KRAS colon cancer cells, suggesting that the chaperone effect of HSP90 on Bcl-2 is highly selective and is associated with the mutational status of KRAS in colon cancer cells. Many cochaperones are involved in determining the selectivity of HSP90 on its clients (43–45). It is likely that signaling driven by mutant KRAS affects the activity of the cofactor needed for HSP90 to chaperone Bcl-2, thus making Bcl-2 more vulnerable to HSP90 inhibition.

How does AUY922 preferentially induce ER stress in mutant KRAS colon cancer cells? It has been reported that killing of mutant KRAS cancer cells by the HSP90 inhibitor 17-AGG or PU-H71 involves degradation of the serine/threonine kinase STK33 (6). However, degradation of STK33 appeared less likely to be involved in AUY922-induced ER stress–mediated apoptosis of mutant KRAS colon cancer cells, as treatment with AUY922 did not cause any significant change in the expression of STK33 in the cells (Supplementary Fig. S13). On the other hand, oncogenic activation of KRAS may promote protein synthesis as does activating mutations of BRAF (46), which represents an underlying mechanism of chronic ER stress in cancer cells by uncoupling the ER protein folding load with the ER protein folding capacity (46). In this case, inhibition of HSP90 conceivably increases the content of proteins that cannot be properly folded and thus exacerbates the ER stress condition more markedly in mutant compared with wild-type KRAS colon cancer cells.

Previous studies have shown that HSP90 inhibition reduces activation of Akt and ERK, which are downstream of multiple clients of HSP90, contributes to induction of apoptosis (24, 47, 48). In particular, Akt itself is known to be a HSP90 client protein (49). However, we found that activation of Akt and ERK was reduced by AUY922 in both mutant and wild-type KRAS colon cancer cells, whereas the latter were markedly less sensitive to apoptosis induced by the inhibitor, suggesting that inhibition of Akt and ERK may not play a major role in AUY922-induced apoptosis in mutant KRAS colon cancer cells. Moreover, our finding that colon cancer cells that harbor mutations in both BRAF and PI3K that is responsible for activation of Akt (WiDr cells) are resistant to apoptosis induced by AUY922 further highlights the selectivity of AUY922 for mutant KRAS colon cancer cells.

The cytotoxic effect of AUY922 on mutant KRAS colon cancer cells was mirrored by inhibition of the growth of mutant KRAS colon cancer xenografts, which, in accordance with the findings in colon cancer cell lines, was mediated by Bim and associated with ER stress. This suggests that clinical evaluation of the efficacy of AUY922 in patients with metastatic colon cancers carrying activating mutations of KRAS is warranted, and that agents that potentiate the apoptosis-inducing effect of Bim, such as inhibitors of the prosurvival Bcl-2 family proteins, may be considered for combination with AUY922 in the treatment colon cancer (50). As a precedent, although the HSP90 inhibitor ganetespib showed only modest clinical activity in patients with mutant KRAS NSCLC, combinations of the inhibitor and other agents have been proposed (37, 38).

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Authors' Contributions

Conception and design: C.Y. Wang, X.D. Zhang, C.C. Jiang

Development of methodology: C.Y. Wang, S.T. Guo, X.G. Yan, L. Jin

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): C.Y. Wang, S.T. Guo, J.Y. Wang, F. Liu, Y.Y. Zhang, X.G. Yan

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): C.Y. Wang, J.Y. Wang, H. Yari, X.G. Yan, L. Jin, X.D. Zhang

Writing, review, and/or revision of the manuscript: C.Y. Wang, H. Yari, X.D. Zhang, C.C. Jiang

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): C.Y. Wang, X.G. Yan

Study supervision: X.D. Zhang, C.C. Jiang

Grant Support

This study was supported by Cancer Council NSW, Australia (RG 15-08), which was awarded to X.D. Zhang. C.C. Jiang and L. Jin are recipients of Cancer Institute NSW Fellowships. X.D. Zhang is supported by a Senior Research Fellowship of NHMRC.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Footnotes

  • Note: Supplementary data for this article are available at Molecular Cancer Therapeutics Online (http://mct.aacrjournals.org/).

  • Received September 24, 2015.
  • Revision received December 22, 2015.
  • Accepted January 4, 2016.

References

  1. 1.↵
    1. Hugen N,
    2. Brown G,
    3. Glynne-Jones R,
    4. de Wilt JH,
    5. Nagtegaal ID
    . Advances in the care of patients with mucinous colorectal cancer. Nat Rev Clin Oncol 2015;140:1–9.
    OpenUrl
  2. 2.↵
    1. Misale S,
    2. Yaeger R,
    3. Hobor S,
    4. Scala E,
    5. Janakiraman M,
    6. Liska D,
    7. et al.
    Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in colorectal cancer. Nature 2012;486:532–6.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Wheeler DL,
    2. Dunn EF,
    3. Harari PM
    . Understanding resistance to EGFR inhibitors-impact on future treatment strategies. Nat Rev Clin Oncol 2010;7:493–507.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Solit DB,
    2. Rosen N
    . Hsp90: a novel target for cancer therapy. Curr Top Med Chem 2006;6:1205–14.
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Qi X,
    2. Xie C,
    3. Hou S,
    4. Li G,
    5. Yin N,
    6. Dong L,
    7. et al.
    Identification of a ternary protein-complex as a therapeutic target for K-Ras-dependent colon cancer. Oncotarget 2014;5:4269–82.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Azoitei N,
    2. Hoffmann CM,
    3. Ellegast JM,
    4. Ball CR,
    5. Obermayer K,
    6. Gossele U,
    7. et al.
    Targeting of KRAS mutant tumors by HSP90 inhibitors involves degradation of STK33. J Exp Med 2012;209:697–711.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. Cercek A,
    2. Shia J,
    3. Gollub M,
    4. Chou JF,
    5. Capanu M,
    6. Raasch P,
    7. et al.
    Ganetespib, a novel Hsp90 inhibitor in patients with KRAS mutated and wild type, refractory metastatic colorectal cancer. Clin Colorectal Cancer 2014;13:207–12.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Sellers WR,
    2. Fisher DE
    . Apoptosis and cancer drug targeting. J Clin Invest 1999;104:1655–61.
    OpenUrlCrossRefPubMed
  9. 9.↵
    1. Cohen-Saidon C,
    2. Carmi I,
    3. Keren A,
    4. Razin E
    . Antiapoptotic function of Bcl-2 in mast cells is dependent on its association with heat shock protein 90beta. Blood 2006;107:1413–20.
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    1. He K,
    2. Zheng X,
    3. Zhang L,
    4. Yu J
    . Hsp90 inhibitors promote p53-dependent apoptosis through PUMA and Bax. Mol Cancer Ther 2013;12:2559–68.
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    1. Busacca S,
    2. Law EW,
    3. Powley IR,
    4. Proia DA,
    5. Sequeira M,
    6. Le Quesne J,
    7. et al.
    Resistance to HSP90 inhibition involving loss of MCL1 addiction. Oncogene 2015;213:1–10.
    OpenUrl
  12. 12.↵
    1. Lee DH,
    2. Sung KS,
    3. Bartlett DL,
    4. Kwon YT,
    5. Lee YJ
    . HSP90 inhibitor NVP-AUY922 enhances TRAIL-induced apoptosis by suppressing the JAK2-STAT3-Mcl-1 signal transduction pathway in colorectal cancer cells. Cell Signal 2015;27:293–305.
    OpenUrlCrossRefPubMed
  13. 13.↵
    1. Kim YJ,
    2. Lee SA,
    3. Myung SC,
    4. Kim W,
    5. Lee CS
    . Radicicol, an inhibitor of Hsp90, enhances TRAIL-induced apoptosis in human epithelial ovarian carcinoma cells by promoting activation of apoptosis-related proteins. Mol Cell Biochem 2012;359:33–43.
    OpenUrlCrossRefPubMed
  14. 14.↵
    1. Harding HP,
    2. Calfon M,
    3. Urano F,
    4. Novoa I,
    5. Ron D
    . Transcriptional and translational control in the Mammalian unfolded protein response. Annu Rev Cell Dev Biol 2002;18:575–99.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Zhang K,
    2. Kaufman RJ
    . Signaling the unfolded protein response from the endoplasmic reticulum. J Biol Chem 2004;279:25935–8.
    OpenUrlFREE Full Text
  16. 16.↵
    1. Schroder M,
    2. Kaufman RJ
    . The mammalian unfolded protein response. Annu Rev Biochem 2005;74:739–89.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Jiang CC,
    2. Lucas K,
    3. Avery-Kiejda KA,
    4. Wade M,
    5. deBock CE,
    6. Thorne RF,
    7. et al.
    Up-regulation of Mcl-1 is critical for survival of human melanoma cells upon endoplasmic reticulum stress. Cancer Res 2008;68:6708–17.
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    1. Li J,
    2. Lee B,
    3. Lee AS
    . Endoplasmic reticulum stress-induced apoptosis: multiple pathways and activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by p53. J Biol Chem 2006;281:7260–70.
    OpenUrlAbstract/FREE Full Text
  19. 19.↵
    1. Puthalakath H,
    2. O'Reilly LA,
    3. Gunn P,
    4. Lee L,
    5. Kelly PN,
    6. Huntington ND,
    7. et al.
    ER stress triggers apoptosis by activating BH3-only protein Bim. Cell 2007;129:1337–49.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Guo ST,
    2. Chi MN,
    3. Yang RH,
    4. Guo XY,
    5. Zan LK,
    6. Wang CY,
    7. et al.
    INPP4B is an oncogenic regulator in human colon cancer. Oncogene 2015;361:1–13.
    OpenUrl
  21. 21.↵
    1. Tay KH,
    2. Liu X,
    3. Chi M,
    4. Jin L,
    5. Jiang CC,
    6. Guo ST,
    7. et al.
    Involvement of vacuolar H(+)-ATPase in killing of human melanoma cells by the sphingosine kinase analogue FTY720. Pigment Cell Melanoma Res 2015;28:171–83.
    OpenUrlCrossRefPubMed
  22. 22.↵
    1. Werstuck GH,
    2. Lentz SR,
    3. Dayal S,
    4. Hossain GS,
    5. Sood SK,
    6. Shi YY,
    7. et al.
    Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J Clin Invest 2001;107:1263–73.
    OpenUrlCrossRefPubMed
  23. 23.↵
    1. Lai F,
    2. Guo ST,
    3. Jin L,
    4. Jiang CC,
    5. Wang CY,
    6. Croft A,
    7. et al.
    Cotargeting histone deacetylases and oncogenic BRAF synergistically kills human melanoma cells by necrosis independently of RIPK1 and RIPK3. Cell Death Dis 2013;4:e655.
    OpenUrlCrossRefPubMed
  24. 24.↵
    1. Koga F,
    2. Xu W,
    3. Karpova TS,
    4. McNally JG,
    5. Baron R,
    6. Neckers L
    . Hsp90 inhibition transiently activates Src kinase and promotes Src-dependent Akt and Erk activation. Proc Natl Acad Sci U S A 2006;103:11318–22.
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Eccles SA,
    2. Massey A,
    3. Raynaud FI,
    4. Sharp SY,
    5. Box G,
    6. Valenti M,
    7. et al.
    NVP-AUY922: a novel heat shock protein 90 inhibitor active against xenograft tumor growth, angiogenesis, and metastasis. Cancer Res 2008;68:2850–60.
    OpenUrlAbstract/FREE Full Text
  26. 26.↵
    1. Garon EB,
    2. Finn RS,
    3. Hamidi H,
    4. Dering J,
    5. Pitts S,
    6. Kamranpour N,
    7. et al.
    The HSP90 inhibitor NVP-AUY922 potently inhibits non-small cell lung cancer growth. Mol Cancer Ther 2013;12:890–900.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    1. Jiang CC,
    2. Chen LH,
    3. Gillespie S,
    4. Wang YF,
    5. Kiejda KA,
    6. Zhang XD,
    7. et al.
    Inhibition of MEK sensitizes human melanoma cells to endoplasmic reticulum stress-induced apoptosis. Cancer Res 2007;67:9750–61.
    OpenUrlAbstract/FREE Full Text
  28. 28.↵
    1. Gallerne C,
    2. Prola A,
    3. Lemaire C
    . Hsp90 inhibition by PU-H71 induces apoptosis through endoplasmic reticulum stress and mitochondrial pathway in cancer cells and overcomes the resistance conferred by Bcl-2. Biochim Biophys Acta 2013;1833:1356–66.
    OpenUrlCrossRef
  29. 29.↵
    1. Tseng HY,
    2. Jiang CC,
    3. Croft A,
    4. Tay KH,
    5. Thorne RF,
    6. Yang F,
    7. et al.
    Contrasting effects of nutlin-3 on TRAIL- and docetaxel-induced apoptosis due to upregulation of TRAIL-R2 and Mcl-1 in human melanoma cells. Mol Cancer Ther 2010;9:3363–74.
    OpenUrlAbstract/FREE Full Text
  30. 30.↵
    1. Wu LL,
    2. Russell DL,
    3. Wong SL,
    4. Chen M,
    5. Tsai TS,
    6. St John JC,
    7. et al.
    Mitochondrial dysfunction in oocytes of obese mothers: transmission to offspring and reversal by pharmacological endoplasmic reticulum stress inhibitors. Development 2015;142:681–91.
    OpenUrlAbstract/FREE Full Text
  31. 31.↵
    1. Asahi J,
    2. Kamo H,
    3. Baba R,
    4. Doi Y,
    5. Yamashita A,
    6. Murakami D,
    7. et al.
    Bisphenol A induces endoplasmic reticulum stress-associated apoptosis in mouse non-parenchymal hepatocytes. Life Sci 2010;87:431–8.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Volkmann K,
    2. Lucas JL,
    3. Vuga D,
    4. Wang X,
    5. Brumm D,
    6. Stiles C,
    7. et al.
    Potent and selective inhibitors of the inositol-requiring enzyme 1 endoribonuclease. J Biol Chem 2011;286:12743–55.
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Desale SS,
    2. Raja SM,
    3. Kim JO,
    4. Mohapatra B,
    5. Soni KS,
    6. Luan H,
    7. et al.
    Polypeptide-based nanogels co-encapsulating a synergistic combination of doxorubicin with 17-AAG show potent anti-tumor activity in ErbB2-driven breast cancer models. J Control Release 2015;208:59–66.
    OpenUrlCrossRefPubMed
  34. 34.↵
    1. Tanimoto A,
    2. Yamada T,
    3. Nanjo S,
    4. Takeuchi S,
    5. Ebi H,
    6. Kita K,
    7. et al.
    Receptor ligand-triggered resistance to alectinib and its circumvention by Hsp90 inhibition in EML4-ALK lung cancer cells. Oncotarget 2014;5:4920–8.
    OpenUrlCrossRefPubMed
  35. 35.↵
    1. Hong YS,
    2. Jang WJ,
    3. Chun KS,
    4. Jeong CH
    . Hsp90 inhibition by WK88-1 potently suppresses the growth of gefitinib-resistant H1975 cells harboring the T790M mutation in EGFR. Oncol Rep 2014;31:2619–24.
    OpenUrlPubMed
  36. 36.↵
    1. Smyth T,
    2. Paraiso KH,
    3. Hearn K,
    4. Rodriguez-Lopez AM,
    5. Munck JM,
    6. Haarberg HE,
    7. et al.
    Inhibition of HSP90 by AT13387 delays the emergence of resistance to BRAF inhibitors and overcomes resistance to dual BRAF and MEK inhibition in melanoma models. Mol Cancer Ther 2014;13:2793–804.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Socinski MA,
    2. Goldman J,
    3. El-Hariry I,
    4. Koczywas M,
    5. Vukovic V,
    6. Horn L,
    7. et al.
    A multicenter phase II study of ganetespib monotherapy in patients with genotypically defined advanced non-small cell lung cancer. Clin Cancer Res 2013;19:3068–77.
    OpenUrlAbstract/FREE Full Text
  38. 38.↵
    1. Acquaviva J,
    2. Smith DL,
    3. Sang J,
    4. Friedland JC,
    5. He S,
    6. Sequeira M,
    7. et al.
    Targeting KRAS-mutant non-small cell lung cancer with the Hsp90 inhibitor ganetespib. Mol Cancer Ther 2012;11:2633–43.
    OpenUrlAbstract/FREE Full Text
  39. 39.↵
    1. Powers MV,
    2. Valenti M,
    3. Miranda S,
    4. Maloney A,
    5. Eccles SA,
    6. Thomas G,
    7. et al.
    Mode of cell death induced by the HSP90 inhibitor 17-AAG (tanespimycin) is dependent on the expression of pro-apoptotic BAX. Oncotarget 2013;4:1963–75.
    OpenUrlCrossRefPubMed
  40. 40.↵
    1. Mayor-Lopez L,
    2. Tristante E,
    3. Carballo-Santana M,
    4. Carrasco-Garcia E,
    5. Grasso S,
    6. Garcia-Morales P,
    7. et al.
    Comparative study of 17-AAG and NVP-AUY922 in pancreatic and colorectal cancer cells: are there common determinants of sensitivity? Transl Oncol 2014;7:590–604.
    OpenUrlCrossRefPubMed
  41. 41.↵
    1. Davenport EL,
    2. Moore HE,
    3. Dunlop AS,
    4. Sharp SY,
    5. Workman P,
    6. Morgan GJ,
    7. et al.
    Heat shock protein inhibition is associated with activation of the unfolded protein response pathway in myeloma plasma cells. Blood 2007;110:2641–9.
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    1. Huber AL,
    2. Lebeau J,
    3. Guillaumot P,
    4. Petrilli V,
    5. Malek M,
    6. Chilloux J,
    7. et al.
    p58(IPK)-mediated attenuation of the proapoptotic PERK-CHOP pathway allows malignant progression upon low glucose. Mol Cell 2013;49:1049–59.
    OpenUrlCrossRefPubMed
  43. 43.↵
    1. Li J,
    2. Soroka J,
    3. Buchner J
    . The Hsp90 chaperone machinery: conformational dynamics and regulation by co-chaperones. Biochim Biophys Acta 2012;1823:624–35.
    OpenUrlCrossRefPubMed
  44. 44.↵
    1. Li J,
    2. Buchner J
    . Structure, function and regulation of the hsp90 machinery. Biomed J 2013;36:106–17.
    OpenUrlCrossRefPubMed
  45. 45.↵
    1. Walton-Diaz A,
    2. Khan S,
    3. Bourboulia D,
    4. Trepel JB,
    5. Neckers L,
    6. Mollapour M
    . Contributions of co-chaperones and post-translational modifications towards Hsp90 drug sensitivity. Future Med Chem 2013;5:1059–71.
    OpenUrlCrossRefPubMed
  46. 46.↵
    1. Croft A,
    2. Tay KH,
    3. Boyd SC,
    4. Guo ST,
    5. Jiang CC,
    6. Lai F,
    7. et al.
    Oncogenic activation of MEK/ERK primes melanoma cells for adaptation to endoplasmic reticulum stress. J Invest Dermatol 2014;134:488–97.
    OpenUrlCrossRefPubMed
  47. 47.↵
    1. Luo H,
    2. Yang Y,
    3. Duan J,
    4. Wu P,
    5. Jiang Q,
    6. Xu C
    . PTEN-regulated AKT/FoxO3a/Bim signaling contributes to reactive oxygen species-mediated apoptosis in selenite-treated colorectal cancer cells. Cell Death Dis 2013;4:e481.
    OpenUrlCrossRefPubMed
  48. 48.↵
    1. Shinjyo T,
    2. Kuribara R,
    3. Inukai T,
    4. Hosoi H,
    5. Kinoshita T,
    6. Miyajima A,
    7. et al.
    Downregulation of Bim, a proapoptotic relative of Bcl-2, is a pivotal step in cytokine-initiated survival signaling in murine hematopoietic progenitors. Mol Cell Biol 2001;21:854–64.
    OpenUrlAbstract/FREE Full Text
  49. 49.↵
    1. Basso AD,
    2. Solit DB,
    3. Chiosis G,
    4. Giri B,
    5. Tsichlis P,
    6. Rosen N
    . Akt forms an intracellular complex with heat shock protein 90 (Hsp90) and Cdc37 and is destabilized by inhibitors of Hsp90 function. J Biol Chem 2002;277:39858–66.
    OpenUrlAbstract/FREE Full Text
  50. 50.↵
    1. Lessene G,
    2. Czabotar PE,
    3. Colman PM
    . BCL-2 family antagonists for cancer therapy. Nat Rev Drug Discov 2008;7:989–1000.
    OpenUrlCrossRefPubMed
Back to top
Molecular Cancer Therapeutics: 15 (3)
March 2016
Volume 15, Issue 3

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Email Article
Citation Tools
Inhibition of HSP90 by AUY922 Preferentially Kills Mutant KRAS Colon Cancer Cells by Activating Bim through ER Stress
Chun Yan Wang, Su Tang Guo, Jia Yu Wang, Fen Liu, Yuan Yuan Zhang, Hamed Yari, Xu Guang Yan, Lei Jin, Xu Dong Zhang and Chen Chen Jiang
Mol Cancer Ther March 1 2016 (15) (3) 448-459; DOI: 10.1158/1535-7163.MCT-15-0778
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Advertisement