Table 2.

Sequencing of BRCA1 in SUM149.B1.S*

Cell lineReference sequence for BRCA1 CAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGCRISPR-Induced mutationSubcloned colonies sequenced (#)Estimated allele frequency
SUM149CAA-CCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGN/A201.00
SUM149.B1.S*CAA-CCTAG——————————————————————————–TAAG80-bp Deletion200.66
CAA-CCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGSUM149 (2288delT)0.33