Table 1.

Best siRNA sequences and in vivo tolerability of candidate targets

Targeting speciesTolerability assessment
siRNATargetsiRNA sequence (sense strand, overhang not shown)IC50 (nmol/L) (siSTABLE)HumanMouseBody weight changeLiver toxicity
NTCN/AUGGUUUACAUGUUGUGUGAN/AN/AN/A4%No
hRAN_1.21RanGUGUGCCACCUCAUUAUUA0.07XNo7%No
KRAS_1.24KRASUGCAGUUGAUUACUUCUUA0.04XNo4%No
KRAS_1.17KRASGCAUGCAGUUGAUUACUUC0.08XNo5%No
BIRC5_1.10BIRC5GAGACAGAAUAGAGUGAUA0.15XNo6%No
BIRC5_1.14BIRC5GUAGAUGCAUGACUUGUGU0.11XNo6%No
NHP2L1_1.1NHP2L1GCUGUGUGAAGACAAGAAU0.16XX2%No
NHP2L1_1.6NHP2L1GCUGCUGUGUGAAGACAAG0.12XX3%No
CDCA1_1.2CDCA1GUGGCAUUAUCAACUUUAU0.25XX8%No
CDCA1_1.5CDCA2CAACUUUAUUCACUUCAGA0.67XX5%No
EIF3S6_1.14EIF3S6UCUUAAUGCAGAAUUGGGA0.002XX4%No
EIF3S6_1.18EIF3S6CAGCCAUGGAAGACCUUAC0.003XX0%No
RPL37A_1.12RPL37AGGUGAAGAAAAUUGAAAUC0.026XX−32%Yes
RPL37A_1.1RPL37ACCGGAAAAUGGUGAAGAAA0.044XX−14%Yes
RPS21_1.6RPS21UGAACGUGGCCGAGGUUGA0.02XX−10%Yes
RPS21_1.9RPS21GCGAGUUCGUGGACCUGUA0.007XX0%Yes
PSMA2_1.7PSMA2CGACCAUAUUUAUUUCAGU0.015XX−10%Yes
PSMA2_1.17PSMA2AUCUUAACCCUAAAGGAAA0.014XX−11%Yes
PSMD2_1.10PSMD2AGACUGAGCUCAAGGAUAC0.0002XX−13%Yes
PSMD2_1.17PSMD2GAAGGAAAUCUAUGAGAAC0.0001XX−25%Yes
RAN_1.1RANAGAAGAAUCUUCAGUACUA0.09XXDeath after 2 dosesYes
RAN_1.6RANGCAUAGAGAUCUGGUACGA0.06XXDeath after 2 dosesYes
KIF11_1.1KIF11_1.1GAGAAGAGCUUGUUAAAAU1.47XX
Aurora BAurora BIC50 > 5 nM for all siRNAs
KNTCKNTCIC50 > 5 nM for all siRNAs

NOTE: To determine the IC50 of siRNA, each siRNA was transfected into relevant cancer cell lines using Lipofectamine 2000. mRNA level of the target gene was then determined using the branched DNA assay. For tolerability determination, each siRNA was formulated into the lipid nanoparticle formulation and administered via i.v. into nontumor-bearing mice at 2 mg siRNA/kg, twice/week for 3 weeks. Tolerability was monitored via body weight change, increase of ALT and AST, as well as gross liver morphology and color changes at the end of the dosing period.