Molecular Cancer Therapeutics Chemical and Biological Aspects of Inflammation and Cancer Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Molecular Cancer Therapeutics 6, 1823-1830, June 1, 2007. doi: 10.1158/1535-7163.MCT-06-0771
© 2007 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, F.
Right arrow Articles by Mo, Y.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, F.
Right arrow Articles by Mo, Y.-Y.

Research Articles: Therapeutics, Targets, and Development

Gam1-associated alterations of drug responsiveness through activation of apoptosis

Fangting Wu1, Susanna Chiocca2, William T. Beck3 and Yin-Yuan Mo1

1 Department of Medical Microbiology, Immunology and Cell Biology, Southern Illinois University School of Medicine, Springfield, Illinois; 2 European Institute of Oncology, Department of Experimental Oncology, Milan, Italy; and 3 Department of Biopharmaceutical Sciences, University of Illinois at Chicago, Chicago, Illinois

Requests for reprints: Yin-Yuan Mo, Department of Medical Microbiology, Immunology and Cell Biology, Southern Illinois University School of Medicine, 801 North Rutledge, P.O. Box 19626, Springfield, IL 62794. Phone: 217-545-8508. E-mail: ymo{at}siumed.edu

Abstract

An early gene product, Gam1, encoded by the avian adenovirus CELO, is an inhibitory protein for the sumoylation machinery, which has been implicated in regulating a variety of cellular pathways. In this study, we found that Gam1 effectively suppressed both constitutive and inducible sumoylation and caused significant cell growth inhibition. This Gam1-mediated cell growth inhibition was associated with induction of apoptosis. In particular, Gam1 induced caspase-3 activity as detected by immunostaining and Western blot. Of interest, like the Ubc9 dominant-negative mutant, Gam1 also sensitized cells to DNA-damaging agents such as topotecan and doxorubicin and non–DNA-damaging agents such as paclitaxel and vincristine. Taken together, our findings suggest that activation of the caspase pathways is at least in part responsible for the increased apoptosis in Gam1-expressing cells and, thus, contributes to the growth inhibition and enhanced chemosensitivity. [Mol Cancer Ther 2007;6(6):1823–30]

Introduction

Gam1, an early protein encoded by the avian adenovirus CELO (1), is a strong and global transcriptional activator of both viral and cellular genes and it inactivates HDAC1 (2). Recently, Gam1 has been shown to inhibit the sumoylation pathway by reduction of the essential sumoylation enzymes E1 and E2 (Ubc9; ref. 3). Therefore, Gam1 has been successfully used to suppress sumoylation (4, 5).

As a posttranslational modification, the sumoylation pathway plays a key role in a wide variety of cellular events (6). Small ubiquitin-like modifier (SUMO), composed of four distinct proteins in humans (SUMO-1, SUMO-2, SUMO-3, and SUMO-4), is a growing member of the ubiquitin and ubiquitin-like superfamily. Like ubiquitination, sumoylation is a multistep process catalyzed by several enzymes, including the activating enzyme E1 (SAE1/SAE2), conjugating enzyme E2 (Ubc9), and E3 ligases. E1 activating enzyme activates SUMO at the expense of ATP, forming a high-energy thioester bond with SUMO. E2 conjugating enzyme Ubc9 receives activated SUMO and then transfers it to a substrate, forming an isopeptide bond between a protein lysine {varepsilon} amino group and the COOH terminus of SUMO (6–9). E3 ligase facilitates this conjugation process by enhancing the conjugation activity or the substrate specificity (10–12).

Given that a large number of cellular regulatory proteins, including oncoproteins, tumor suppressors, cell cycle regulators, and enzymes involved in DNA repair and chromosome stability, have been shown to be targets for sumoylation, deregulation of sumoylation is expected to have a significant effect on cell growth and proliferation, as well as response to environmental stimuli. For instance, several SUMO isoforms are up-regulated during cellular stress, and proteins involved in the cell stress response are sumoylated (13–16). Consequently, alterations of protein sumoylation would affect cancer development and/or tumor drug resistance (17).

In support of this notion, we have previously shown that overexpression of a dominant-negative mutant Ubc9 (Ubc9-DN) is associated with increased sensitivity to DNA-damaging agents (18); furthermore, Ubc9-DN has also a negative effect on tumor growth in the xenograft mouse model (19). In yeast, a defect in the ubc9 gene causes increased sensitivity to genotoxic drugs (20). However, the mechanism underlying sumoylation-mediated drug responsiveness is not fully understood. In particular, it is not clear whether suppression of sumoylation also affects the tumor cell response to non–DNA-damaging agents.

In this study, besides showing suppression of Ubc9 expression and sumoylation by Gam1, we find that overexpression of Gam1 inhibits cell growth. Furthermore, Gam1 enhances the sensitivity to both DNA-damaging and non–DNA-damaging agents, which is likely through activation of caspase-dependent apoptotic pathways.

Materials and Methods

Cell Culture
293T cells and HeLa cells (obtained from American Type Cell Collection) were grown in DMEM (BioWhittaker), supplemented with 10% fetal bovine serum, 2 mmol/L L-glutamine, 100 units of penicillin/mL, and 100 µg of streptomycin/mL. Cells were incubated at 37°C in a humidified chamber supplemented with 5% CO2.

Construction of Plasmids
Myc-tagged Gam1 was previously described (3). To construct GFP-Gam1, the Gam1 coding region was amplified by PCR. PCR primers were GAM1-5.1 (sense), CTCGAGGCCCGCAACCCATTCCGCATG (the Xho1 site was underlined), and GAM1-3.1 (antisense), GAATTCTTACAGAGAATGGTAGGGGTG (the EcoRI site was underlined). The PCR product was first cloned into pCR8 (Invitrogen). After verification by DNA sequencing, it was then subcloned into pEGFP-C3 (Clontech) at XhoI and EcoRI sites. Its expression was further verified by fluorescence microscopy and Western blot.

Transfection
293T cells or HeLa cells were transiently transfected with pSG9M-Gam1 or pSG9M vector (3) by calcium phosphate method as previously described (21). Briefly, cells were seeded at ~30% confluence onto a six-well plate and allowed to grow for ~2 h before transfection. Three micrograms of plasmid DNA were used for each transfection. To monitor transfection efficiency, the transfection reaction was added to a green fluorescent protein (GFP)–expressing plasmid and then examined under a fluorescence microscope 1 day after transfection.

Western Blot
Western blot analysis was carried out according to standard methods. All antibodies, except for topoisomerase I (topo I)–specific antibody TI-I (21), were purchased from commercial sources: Myc antibody (Applied Biological Materials, Inc.), Ubc9 antibody (BD Bioscience), RanGAP1 antibody (Invitrogen), SUMO antibody (Invitrogen), and active caspase-3 antibody (Cell Signaling).

3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide Assays
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays were used to determine the cell growth and responsiveness to anticancer agents as previously described (21). Briefly, cells seeded onto 96-well plates were treated with anticancer drugs at various concentrations and then incubated at 37°C for 3 days before MTT assays.

Detection of Apoptosis by Cell Death ELISA
Apoptosis was detected using cell death detection ELISAplus kit (Roche Ltd.) following the manufacturer's protocol. This detection kit is designed for detection of internucleosomal DNA fragmentation by antibody-mediated capture and cytoplasmic mononucleosome- and oligonucleosome-associated histone-DNA complexes (22). Signals were measured at 405 nm against ABTS solution as a blank and the relative apoptosis levels were calculated accordingly. Briefly, 3 days after transfection, cells were harvested, seeded onto 96-well plates (10,000 per well), and incubated for 2 h to allow cells to attach before lysis for ELISA assays.

Immunofluoresence Staining
Immunofluoresence staining was used to determine the induction of caspase-3 activity in Gam1-transfected cells. Briefly, 3 days after transfection with vector control or Gam1-expressing vector, HeLa cells were fixed with 3% paraformaldehyde and permeabilized by 80% cold methanol. After washing with PBS, coverslips were then incubated in PBS with 3% bovine serum albumin for 10 min at room temperature. Primary antibodies against Myc or the active form of caspase-3 (R&D Systems) in PBS plus 0.1% Tween 20 were then added and incubated for 1 h at room temperature. After three washes with PBS, the cells were incubated with a fluorescence-conjugated secondary antibody in the dark for 1 h. For nuclear staining, the cells were subsequently stained with 0.5 µg/mL Hoechst dye (Sigma-Aldrich) for 5 min before examination under a fluorescence microscope.

Statistical Analysis
The results are applied for statistical analysis. Values shown in graphs were expressed as mean ± SE of at least three independent experiments and were analyzed by Student's t test.

Results

Suppression of Sumoylation by Gam1
Because previous studies have shown that Gam1 can inhibit sumoylation (3), we first asked whether Gam1 has any effect on sumoylation in our cells. After Gam1 expression was confirmed by Western blot with Myc-antibody (not shown), we tested whether Gam1 is able to effectively reduce Ubc9 expression level. As shown in Fig. 1A , there was a direct correlation between expression of Gam1 and suppression of Ubc9, which seemed to be dependent on the time after transfection. For instance, we observed a slight reduction of Ubc9 2 days after transfection; by day 3, however, there was a substantial reduction of Ubc9 in Gam1-transfected cells compared with the vector control (Fig. 1A), consistent with the previous findings (3, 4). Similarly, we also found suppression of Ubc9 expression by Gam1 in HeLa cells (not shown). We then determined whether Gam1 affects sumoylation in these cells. There are two types of sumoylation: constitutive and inducible sumoylation. Constitutive sumoylation occurs under normal conditions, whereas inducible sumoylation occurs in response to different stimuli (13, 23). Therefore, we tested the effect of Gam1 on both types of sumoylation. Because RanGAP1 is the most abundant substrate of SUMO-1 and, in most cases, SUMO-1 is detected as a conjugated form with RanGAP1 (24) under normal conditions, it is a good SUMO substrate for constitutive sumoylation. After 3 days of transfection, SUMO-conjugated RanGAP1 was decreased in Gam1-transfected cells compared with vector control (Fig. 1B, left). Interestingly, there was a nonconjugated RanGAP1 in Gam1-transfected cells, as detected by antibody against RanGAP1, whereas little nonconjugated RanGAP1 was detected in the vector control cells. This was further supported by probing the membrane with SUMO antibody (Fig. 1B, right). These results are consistent with a previous report that Gam1 suppresses sumoylation of RanGAP1 in vitro (3). To further determine whether Gam1 also suppresses stress-induced protein sumoylation, we used DNA topo I, which is largely sumoylated in response to DNA-damaging anticancer drugs such as topotecan (23). Thus, cells were harvested 3 days after transfection, treated with topotecan, and then tested for inducible sumoylation. Because topo I carries several sumoylation sites, there are several sumoylated topo I bands when separated in SDS-PAGE. These slow-migrating topo I–specific bands were shown to react with SUMO-1 antibody (23). As shown in Fig. 1C, Gam1 also suppressed sumoylation of topo I. Therefore, like Ubc9-DN (23, 25), Gam1 suppresses both constitutive and inducible protein sumoylation.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		Figure 1. Gam1 reduces Ubc9 expression and suppresses sumoylation. A, expression of Gam1 substantially reduces the level of the endogenous Ubc9. 293T cells were transfected with either vector or Gam1 and protein was extracted at the indicated day after transfection. The membranes were probed with antibodies against Myc for Gam1, Ubc9, or ß-actin. B, suppression of sumoylation of RanGAP1 by Gam1. *, a nonspecific band. The membranes were probed with anti-RanGAP1, anti-SUMO, or anti–ß-actin antibody. C, suppression of sumoylation of DNA topo I by Gam1. The transfected cells were treated with 10 µmol/L topotecan (TPT) for 30 min and then were harvested for protein extraction. The membranes were probed with anti–topo I or anti–ß-actin antibody. The cells used in both (B) and (C) were harvested at day 3 after transfection.

 
Inhibition of Cell Growth by Gam1
Given the suppression of sumoylation by Gam1, we asked whether Gam1 will have any effect on cell growth. 293T cells were transfected with Gam1 plasmid and cell growth was monitored from day 1 to day 4 after transfection. As shown in Fig. 2A , Gam1-expressing cells grew significantly more slowly than the vector control at days 3 and 4 after transfection. To determine whether this Gam1-induced growth inhibition is cell type specific, we also tested it in HeLa cells and found that Gam1 also inhibited HeLa cell growth with a similar pattern (Fig. 2B).


Figure 2
View larger version (17K):
[in this window]
[in a new window]

  		Figure 2. Inhibition of cell growth by Gam1. 293T (A) or HeLa (B) cells were transfected with vector control or Gam1 as described in Materials and Methods, and then split into 96-well plates. Relative cell growth was determined by MTT assays at indicated times as described in Materials and Methods. A similar cell growth inhibition pattern was seen for both cell lines. **, P < 0.01.

 
To directly detect the effect of Gam1 on cell growth, we constructed a plasmid expressing GFP-Gam1. After verification of its ability to suppress Ubc9 and sumoylation (not shown), we introduced this plasmid into 293T cells and then monitored the growth of the GFP-Gam1–expressing cell population from day 1 to day 4 under a fluorescence microscope. The GFP-Gam1 cell population diminished very rapidly during 4 days, and thus the ratio of GFP-Gam1–expressing cells versus total cell population decreased substantially (Fig. 3B ). In contrast, the GFP vector–expressing population gradually increased from day 1 to day 2 and then remained relatively stable after that (Fig. 3A). From a total of 600 cells counted each day, we found a sharp contrast in the ratio between the GFP vector and GFP-Gam1 (Fig. 3B). In other words, the GFP vector–expressing cells can still divide without losing GFP within 4 days after transfection, whereas the vast majority of the GFP-Gam1–expressing cells are eliminated within the same period of time. These results suggest that Gam1 plays a direct role in cell growth inhibition.


Figure 3
View larger version (34K):
[in this window]
[in a new window]

  		Figure 3. Effect of GFP-Gam1 on cell growth. 293T cells were transfected with GFP vector or GFP-Gam1. GFP-positive cells were determined under a microscope and the relative number of GFP-positive cells versus total cell number was calculated by counting >200 total cells for each experiment. A, representative microscopic fields of cells at the indicated times after transfection. Cells in blue were stained with Hoechst dye, representing the total number of cells in the field. B, quantitative analysis of data as seen in (A). Columns, mean of three independent experiments; bars, SE.

 
To determine whether Gam1 affects cell growth by regulation of cell cycle, we carried out cell cycle analysis of Gam1-transfected cells and found that Gam1 only slightly increased cell population at G2-M phase (not shown), suggesting that cell cycle regulation may not play a significant role in Gam1-mediated cell growth inhibition.

Growth Inhibition by Gam1 Is Associated with Increased Cell Apoptosis through Activation of Caspase Pathways
We then examined whether Gam1-associated growth inhibition is due to the induction of apoptosis. Using cell death ELISA kit, which specifically detects the cytoplasmic histone-associated DNA fragment, we found that there was an almost 4-fold increase in apoptosis in cellular extract from Gam1-transfected cells compared with the vector control (Fig. 4A ). Hence, Gam1-mediated cell growth inhibition is associated with induction of apoptosis pathways. This is surprising because Gam-1 was originally identified in a screen for antiapoptotic protein (1). However, there was a fundamental difference. In this study, we used transformed cells whereas the previous study was carried out in primary human skin fibroblasts (1), which implies that Gam1 could function in an opposite way in different types of cells.


Figure 4
View larger version (17K):
[in this window]
[in a new window]

  		Figure 4. Gam1-induced cell growth inhibition is associated with cell apoptosis. Gam1-expressing cells were used to determine cell apoptosis by cell death ELISA assay 3 d after transfection as detailed in Materials and Methods. Relative apoptosis is expressed relative to the vector control as 1. A, the general caspase inhibitor z-VAD-fmk (VAD) and caspase-3 inhibitor (C3-I) are able to reverse Gam1-induced cell apoptosis. B, suppression of Gam1-induced growth inhibition by z-VAD-fmk or caspase-3 inhibitor. 293T cells were first transfected with Gam1 or vector control and then seeded onto 96-well plates 1 d after transfection. Caspase inhibitors were added after cells were attached. Columns, mean of three independent experiments; bars, SE. **, P < 0.01; *, P < 0.05.

 
To further determine whether Gam1-induced apoptosis is caspase dependent, we treated Gam1-transfected cells with the general caspase inhibitor z-VAD-fmk 24 h after transfection. As shown in Fig. 4A, z-VAD-fmk substantially suppressed Gam1-induced apoptosis, suggesting that it is caspase dependent. We then tested whether z-VAD-fmk has any effect on Gam1-induced cell growth inhibition and found that this agent partially reversed Gam1-induced growth inhibition (Fig. 4B). To further dissect Gam1-induced apoptosis, we treated Gam1-transfected cells with caspase-3 inhibitor because caspase-3 has been shown to be a key protein enhancing chemosensitivity (26). Like the general caspase inhibitor, caspase-3 inhibitor was also able to reverse Gam1-induced apoptosis and cell growth inhibition (Fig. 4A and B).

Finally, we used antibody against active caspase-3 to stain Gam1-transfected cells. As shown Fig. 5A , activation of caspase-3 (green) was detected in Gam1-transfected cells and colocalized with Gam1 (red). In contrast, active caspase-3 signal was much weaker in the vector control. Western blot also indicated that Gam1 induced caspase-3 activity (Fig. 5B). Therefore, these results suggest that Gam1 induces caspase-dependent pathways, which seems to be in part through activation of caspase-3.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

  		Figure 5. Activation of caspase-3 in Gam1-expressing cells. A, detection of caspase-3 by immunostaining. HeLa cells were transfected with Gam1 and subjected to immunostaining with anti-Myc (red) or anti–active caspase-3 antibody (green); nuclear staining with Hoechst dye is shown as blue. Note that the intensity of green fluorescence is much higher in Gam1-transfected cells than in vector control, suggesting activation of caspase-3 by Gam1 expression. B, detection of caspase-3 by Western blot. Active caspase-3 products are indicated by 12-kDa and 17-kDa bands.

 
Gam1 Increases the Sensitivity to Both DNA-Damaging and Non–DNA-Damaging Anticancer Drugs
After showing that Gam1-induced growth inhibition is associated with caspase pathway, we then determined whether Gam1 affects cell response to cytotoxic drugs. Because we have previously shown that suppression of Ubc9 function by Ubc9-DN causes reduction of overall sumoylation and sensitizes tumor cells to DNA-damaging anticancer agents such as VM26 and topotecan (18), we asked whether the suppression of sumoylation by Gam1 also increases cell sensitivity to these agents. Cells were first transfected with either vector alone or Gam1; 24 h later, they were treated with either topotecan or doxorubicin, which is known to cause DNA damage (27). Because Gam1 itself inhibits cell growth (Figs. 2 and 3), we normalized data with DMSO control as 100% for vector control or Gam1. Consistent with our previous report (18), Gam1 enhanced the sensitivity of cells to doxorubicin by 1.8-fold and to topotecan by 3.0-fold when compared with the vector control (Table 1 ). We also treated the same transfected cells with various doses of UV radiation and found that Gam1-expressing cells were more sensitive to UV treatment than the vector control, with a 2-fold increase (Table 1). These findings are in agreement with the notion that sumoylation is involved in the regulation of DNA repair pathways (28–31), and suppression of sumoylation may have an adverse effect on DNA repair, leading to increased sensitivity to these agents.


View this table:
[in this window]
[in a new window]

  		Table 1. Increased sensitivity to DNA-damaging agents in Gam1-transfected cells

 
Not clear, however, is whether Gam1 has any effect on the sensitivity of cells to non–DNA-damaging agents. Thus, we tested vincristine and paclitaxel, both of which are known to target tubulins or microtubules (32). Of considerable interest, MTT assays revealed that Gam1 increased the sensitivity of cells to both agents (Table 2 ), suggesting that Gam1 also affects cytotoxicity mediated by non–DNA-damaging agents. To determine whether increased sensitivity to non–DNA-damaging agents caused by Gam1 is due to suppression of sumoylation, we used the Ubc9-DN approach to suppress sumoylation as previously described (23, 25). Like Gam1, Ubc9-DN also sensitized cells to these non–DNA-damaging agents (Table 2). Thus, both Gam1 and Ubc9-DN can sensitize cells not only to DNA-damaging agents but also to non–DNA-damaging agents.


View this table:
[in this window]
[in a new window]

  		Table 2. Increased sensitivity to non–DNA-damaging agents in Gam1- or Ubc9-DN–transfected cells

 
It is well known that despite different mechanisms involved, all of the above agents are known to cause cell apoptosis (32, 33). To test the possibility that Gam1 affects the response to apoptosis-inducing agents but not to non–apoptosis-inducing agents, we examined the effect of Gam1 on the sensitivity of cells to merbarone, a catalytic topo II inhibitor. Unlike complex-forming topo II inhibitors such as VM26 or doxorubicin that stabilize the DNA-topo II complex, causing double-strand breaks and leading to cellular apoptosis (33), merbarone inhibits topo II–mediated DNA cleavage (34). Although merbarone can cause apoptosis in leukemia cells at a high concentration (35, 36), we detected no induction of apoptosis in merbarone-treated 293T cells at 100 µmol/L by the apoptosis assay kit or active caspase-3 activity. Under this condition, Gam1 had no significant effect on the merbarone-induced cytotoxicity (Table 2). It seems that Gam1 can synergize only with apoptosis-inducing agents and not with non–apoptosis-inducing agents. Finally, to determine whether Gam1 causes drug sensitivity through activation of caspase pathways, we detected the activation of caspase-3 activity by Western blot. As shown in Fig. 6 , a higher level of active caspase-3 level was detected in cells transfected with Gam1 plus topotecan treatment than with either Gam1 or topotecan alone, suggesting that increased caspase-3 activity induced by Gam1 may contribute to the enhanced sensitivity to topotecan.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

  		Figure 6. Enhancement of caspase-3 activity in topotecan-treated cells by Gam1. 293T cells were first transfected with Gam1 or vector control. One day later, the transfected cells were treated with either DMSO or topotecan (10 µmol/L) for 8 h before extraction of total protein for Western blot. Protein bands with molecular weights of 12 and 17 kDa are active caspase-3.

 
Discussion

As a sumoylation inhibitor, Gam1 has been shown to cause degradation of two essential sumoylation enzymes, E1 and Ubc9 (3). In particular, Gam1 interferes with the activity of E1 heterodimer (SAE1/SAE2), leading to the accumulation of SUMO-unmodified substrates (37). In this study, we show that Gam1 causes a significant reduction of Ubc9 and leads to suppression of both constitutive and inducible sumoylation. Furthermore, Gam1 overexpression causes cell growth inhibition, which is likely through activation of caspase-dependent apoptosis pathways. More importantly, like Ubc9-DN, Gam1 also sensitizes cells to both DNA-damaging and non–DNA-damaging agents. In addition to suppression of sumoylation, Gam1 has been shown to inactivate HDAC1 activity (2); this may be, in part, through inhibition of HDAC1 sumoylation although sumoylation of HDAC1 does not seem to be absolutely required for HDAC1 biological activity (38). Therefore, although we cannot exclude the possibility that Gam1 affects cell growth independent of sumoylation, given that both Gam1 and Ubc9-DN induce apoptosis and cause cell growth inhibition, it is reasonable to assume that suppression of sumoylation by Gam1 is, at least in part, responsible for the observed growth inhibition and activation of the caspase-dependent apoptosis pathways.

Sumoylation has been shown to regulate many critical pathways because of its ability to modulate transcription, protein stability, and protein subcellular localization (9). In particular, sumoylation has been implicated in modulating the responsiveness to DNA-damaging anticancer agents, presumably because sumoylation plays a role in DNA repair pathways (30). Our study herein indicates that suppression of sumoylation enhances the sensitivity not only to DNA-damaging but also to non–DNA-damaging agents, suggesting that sumoylation may have a broader role in regulating chemotherapy-mediated cytotoxicity, and thus affecting the efficacy of these agents. Because non–DNA-damaging agents, such as paclitaxel and vincristine, are a class of clinically important anticancer drugs, sumoylation-mediated responsiveness to these agents highlights the potential clinical implications of modulating protein sumoylation.

With regard to the effect of sumoylation on the cellular response to stress, previous investigations have mainly focused on DNA-damaging agents, not only because many DNA repair enzymes are shown to be substrates for sumoylation (30) but also because interruption of the sumoylation machinery has been shown to affect the response to DNA-damaging agents in yeast and mammalian cells (18, 20, 39). It is generally believed that this effect is attributable to the ability of sumoylation to modulate the activity of DNA repair enzymes or their subcellular localization or their stability. For instance, thymidine glycosylase is one of the several DNA glycosylases involved in base excision repair. SUMO conjugation of thymidine glycosylase reduces its affinity for the apurine site, thus facilitating its recycling for subsequent rounds of base excision repair (40, 41). Protein modifications by SUMO have also been shown to play an important role in the repair of double-strand breaks via homologous recombination. Both Rad51 and Rad52 are key components of the eukaryotic homologous recombination machinery, which are involved in the early stages of homologous recombination and directly interact with Ubc9 and SUMO-1 (42, 43). Nuclear depletion of Ubc9 causes significant disruption of Rad51 intracellular trafficking, such that induction of Rad51 nuclear foci by DNA-damaging agents is markedly inhibited (44). Our results with doxorubicin, topotecan, and UV radiation shown in this study further support the role of sumoylation in the cell response to these agents.

However, this cannot explain why suppression of sumoylation also leads to the enhancement of the sensitivity to non–DNA-damaging agents. Apparently, sumoylation can also modulate other cellular pathways that link to the response to these agents. It is well known that many anticancer agents exert cytotoxicity by inducing cellular apoptosis, although the mode of action for each agent may be very different. Despite intensive investigations of sumoylation function, little is known whether or how sumoylation affects cellular apoptosis. Because all the agents tested in this study, except for merbarone, can induce cellular apoptosis, and suppression of sumoylation by either Gam1 or Ubc9-DN enhances the sensitivity to both DNA-damaging and non–DNA-damaging agents but not merbarone, it is conceivable that sumoylation increases the sensitivity to these agents through regulation of cellular apoptosis. Therefore, we directly determined the effect of sumoylation on apoptosis. Our results indicate that suppression of sumoylation increases cellular apoptosis. Furthermore, this enhanced apoptosis is likely due to the activation of caspases, particularly caspase-3, and thus is at least in part responsible for the enhancement of drug sensitivity.

Regulation of apoptosis by sumoylation has clinical implications. It is well known that the vast majority of chemotherapeutic agents, as well as radiation, exert their cytotoxicity through induction of cellular apoptosis (45, 46). Moreover, many therapeutic agents are designed to target the apoptosis machinery. Given the enhancement of chemosensitivity by suppression of sumoylation, antisumoylation may provide a potential approach for cancer therapy.

Footnotes

Grant support: NIH grants CA102630 and CA40570.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 12/12/06; revised 4/25/07; accepted 5/ 2/07.

References

  1. Chiocca S, Baker A, Cotten M. Identification of a novel antiapoptotic protein, GAM-1, encoded by the CELO adenovirus. J Virol 1997;71:3168–77.[Abstract]
  2. Chiocca S, Kurtev V, Colombo R, et al. Histone deacetylase 1 inactivation by an adenovirus early gene product. Curr Biol 2002;12:594–8.[CrossRef][Medline]
  3. Boggio R, Colombo R, Hay RT, et al. A mechanism for inhibiting the SUMO pathway. Mol Cell 2004;16:549–61.[CrossRef][Medline]
  4. Deyrieux AF, Rosas-Acosta G, Ozbun MA, et al. Sumoylation dynamics during keratinocyte differentiation. J Cell Sci 2007;120:125–36.[Abstract/Free Full Text]
  5. Tago K, Chiocca S, Sherr CJ. Sumoylation induced by the Arf tumor suppressor: a p53-independent function. Proc Natl Acad Sci U S A 2005;102:7689–94.[Abstract/Free Full Text]
  6. Seeler JS, Dejean A. Nuclear and unclear functions of SUMO. Nat Rev Mol Cell Biol 2003;4:690–9.[CrossRef][Medline]
  7. Muller S, Hoege C, Pyrowolakis G, et al. SUMO, ubiquitin's mysterious cousin. Nat Rev Mol Cell Biol 2001;2:202–10.[CrossRef][Medline]
  8. Hershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem 1998;67:425–79.[CrossRef][Medline]
  9. Johnson ES. Protein modification by SUMO. Annu Rev Biochem 2004;73:355–82.[CrossRef][Medline]
  10. Kahyo T, Nishida T, Yasuda H. Involvement of PIAS1 in the sumoylation of tumor suppressor p53. Mol Cell 2001;8:713–8.[CrossRef][Medline]
  11. Pichler A, Gast A, Seeler JS, et al. The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 2002;108:109–20.[CrossRef][Medline]
  12. Kagey MH, Melhuish TA, Wotton D. The polycomb protein Pc2 is a SUMO E3. Cell 2003;113:127–37.[CrossRef][Medline]
  13. Shao R, Zhang FP, Tian F, et al. Increase of SUMO-1 expression in response to hypoxia: direct interaction with HIF-1{alpha} in adult mouse brain and heart in vivo. FEBS Lett 2004;569:293–300.[CrossRef][Medline]
  14. Ledl A, Schmidt D, Muller S. Viral oncoproteins E1A and E7 and cellular LxCxE proteins repress SUMO modification of the retinoblastoma tumor suppressor. Oncogene 2005;24:3810–8.[CrossRef][Medline]
  15. Hilgarth RS, Murphy LA, O'Connor CM, et al. Identification of Xenopus heat shock transcription factor-2: conserved role of sumoylation in regulating deoxyribonucleic acid-binding activity of heat shock transcription factor-2 proteins. Cell Stress Chaperones 2004;9:214–20.[CrossRef][Medline]
  16. Zhou W, Ryan JJ, Zhou H. Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J Biol Chem 2004;279:32262–8.[Abstract/Free Full Text]
  17. Mo YY, Moschos SJ. Targeting Ubc9 for cancer therapy. Expert Opin Ther Targets 2005;9:1203–16.[CrossRef][Medline]
  18. Mo YY, Yu Y, Ee PL, et al. Overexpression of a dominant-negative mutant Ubc9 is associated with increased sensitivity to anticancer drugs. Cancer Res 2004;64:2793–8.[Abstract/Free Full Text]
  19. Mo YY, Yu Y, Theodosiou E, et al. A role for Ubc9 in tumorigenesis. Oncogene 2005;24:2677–83.[CrossRef][Medline]
  20. Jacquiau HR, van Waardenburg RC, Reid RJ, et al. Defects in SUMO (small ubiquitin-related modifier) conjugation and deconjugation alter cell sensitivity to DNA topoisomerase I-induced DNA damage. J Biol Chem 2005;280:23566–75.[Abstract/Free Full Text]
  21. Mo YY, Wang P, Beck WT. Functional expression of human DNA topoisomerase I and its subcellular localization in HeLa cells. Exp Cell Res 2000;256:480–90.[CrossRef][Medline]
  22. Liu CY, Takemasa A, Liles WC, et al. Broad-spectrum caspase inhibition paradoxically augments cell death in TNF-{alpha}-stimulated neutrophils. Blood 2003;101:295–304.[Abstract/Free Full Text]
  23. Mo YY, Yu Y, Shen Z, et al. Nucleolar delocalization of human topoisomerase I in response to topotecan correlates with sumoylation of the protein. J Biol Chem 2002;277:2958–64.[Abstract/Free Full Text]
  24. Mahajan R, Delphin C, Guan T, et al. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 1997;88:97–107.[CrossRef][Medline]
  25. Giorgino F, de Robertis O, Laviola L, et al. The sentrin-conjugating enzyme mUbc9 interacts with GLUT4 and GLUT1 glucose transporters and regulates transporter levels in skeletal muscle cells. Proc Natl Acad Sci U S A 2000;97:1125–30.[Abstract/Free Full Text]
  26. Yang XH, Sladek TL, Liu X, et al. Reconstitution of caspase 3 sensitizes MCF-7 breast cancer cells to doxorubicin- and etoposide-induced apoptosis. Cancer Res 2001;61:348–54.[Abstract/Free Full Text]
  27. Tanizawa A, Fujimori A, Fujimori Y, et al. Comparison of topoisomerase I inhibition, DNA damage, and cytotoxicity of camptothecin derivatives presently in clinical trials. J Natl Cancer Inst 1994;86:836–42.[Abstract/Free Full Text]
  28. Lee KM, O'Connell MJ. A new SUMO ligase in the DNA damage response. DNA Repair (Amst) 2006;5:138–41.[CrossRef][Medline]
  29. Yurchenko V, Xue Z, Sadofsky MJ. SUMO modification of human XRCC4 regulates its localization and function in DNA double-strand break repair. Mol Cell Biol 2006;26:1786–94.[Abstract/Free Full Text]
  30. Moschos SJ, Mo YY. Role of SUMO/Ubc9 in DNA Damage Repair and Tumorigenesis. J Mol Histol 2006.
  31. Ulrich HD. The RAD6 pathway: control of DNA damage bypass and mutagenesis by ubiquitin and SUMO. Chembiochem 2005;6:1735–43.[CrossRef][Medline]
  32. Islam MN, Iskander MN. Microtubulin binding sites as target for developing anticancer agents. Mini Rev Med Chem 2004;4:1077–104.[Medline]
  33. Nitiss JL, Beck WT. Antitopoisomerase drug action and resistance. Eur J Cancer 1996;32A:958–66.[CrossRef]
  34. Fortune JM, Osheroff N. Merbarone inhibits the catalytic activity of human topoisomerase II{alpha} by blocking DNA cleavage. J Biol Chem 1998;273:17643–50.[Abstract/Free Full Text]
  35. Otake Y, Mims A, Fernandes DJ. Merbarone induces activation of caspase-activated DNase and excision of chromosomal DNA loops from the nuclear matrix. Mol Pharmacol 2006;69:1477–85.[Abstract/Free Full Text]
  36. Khelifa T, Beck WT. Merbarone, a catalytic inhibitor of DNA topoisomerase II, induces apoptosis in CEM cells through activation of ICE/CED-3-like protease. Mol Pharmacol 1999;55:548–56.[Abstract/Free Full Text]
  37. Boggio R, Passafaro A, Chiocca S. Targeting sumo E1 to ubiquitin ligases: A viral strategy to counteract sumoylation. J Biol Chem 2007; Epub ahead of print March 28.
  38. Colombo R, Boggio R, Seiser C, et al. The adenovirus protein Gam1 interferes with sumoylation of histone deacetylase 1. EMBO Rep 2002;3:1062–8.[CrossRef][Medline]
  39. Mao Y, Sun M, Desai SD, et al. SUMO-1 conjugation to topoisomerase I: A possible repair response to topoisomerase-mediated DNA damage. Proc Natl Acad Sci U S A 2000;97:4046–51.[Abstract/Free Full Text]
  40. Hardeland U, Steinacher R, Jiricny J, et al. Modification of the human thymine-DNA glycosylase by ubiquitin-like proteins facilitates enzymatic turnover. EMBO J 2002;21:1456–64.[CrossRef][Medline]
  41. Baba D, Maita N, Jee JG, et al. Crystal structure of thymine DNA glycosylase conjugated to SUMO-1. Nature 2005;435:979–82.[CrossRef][Medline]
  42. Kovalenko OV, Plug AW, Haaf T, et al. Mammalian ubiquitin-conjugating enzyme Ubc9 interacts with Rad51 recombination protein and localizes in synaptonemal complexes. Proc Natl Acad Sci U S A 1996;93:2958–63.[Abstract/Free Full Text]
  43. Shen Z, Pardington-Purtymun PE, Comeaux JC, et al. Associations of UBE2I with RAD52, UBL1, p53, and RAD51 proteins in a yeast two-hybrid system. Genomics 1996;37:183–6.[CrossRef][Medline]
  44. Saitoh H, Pizzi MD, Wang J. Perturbation of SUMOlation enzyme Ubc9 by distinct domain within nucleoporin RanBP2/Nup358. J Biol Chem 2002;277:4755–63.[Abstract/Free Full Text]
  45. Bergstralh DT, Ting JP. Microtubule stabilizing agents: their molecular signaling consequences and the potential for enhancement by drug combination. Cancer Treat Rev 2006;32:166–79.[CrossRef][Medline]
  46. Fulda S, Debatin KM. Targeting apoptosis pathways in cancer therapy. Curr Cancer Drug Targets 2004;4:569–76.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, F.
Right arrow Articles by Mo, Y.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, F.
Right arrow Articles by Mo, Y.-Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online