Molecular Cancer Therapeutics Chemical and Biological Aspects of Inflammation and Cancer Bridging the Lab and the Clinic in Cancer Medicine
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Molecular Cancer Therapeutics 6, 1300-1309, April 1, 2007. doi: 10.1158/1535-7163.MCT-06-0587
© 2007 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oppenheimer, O.
Right arrow Articles by Gerald, W. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oppenheimer, O.
Right arrow Articles by Gerald, W. L.

Research Articles: Therapeutics, Targets, and Development

The RET oncogene is a critical component of transcriptional programs associated with retinoic acid–induced differentiation in neuroblastoma

Orit Oppenheimer1, Nai-Kong Cheung1 and William L. Gerald2

Departments of 1 Pediatrics and 2 Pathology, Memorial Sloan Kettering Cancer Center, New York, New York

Requests for reprints: William L. Gerald, Department of Pathology, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. Phone: 212-639-5858; Fax: 212-639-4559. E-mail: geraldw{at}mskcc.org

Abstract

Differentiation is a key feature in pathologic classification and prognosis of neuroblastic tumors, although the underlying molecular mechanisms are not well defined. To identify key differentiation-related molecules and pathways, we evaluated gene expression during retinoic acid (RA)–induced differentiation of seven neuroblastic tumor cell lines. Transcriptional response to RA was highly variable among cell lines despite the fact that six of seven showed similar morphologic changes. RA consistently altered expression of a small set of genes, some of which are known to play a role in neurogenesis and differentiation. Expression of genes that were regulated by RA was associated with important clinical subgroups of neuroblastic tumors and were differentially expressed by stroma-rich and stroma-poor subtypes. RET, a receptor tyrosine kinase involved with differentiation, was consistently up-regulated throughout the time course of RA treatment in the majority of neuroblastic tumor cell lines. Interference with RET activation abrogated RA-induced transcriptional programs and differentiation, suggesting a key role of RET in this process. The core set of RA-regulated genes includes critical molecular components of pathways necessary for neuroblastic tumor differentiation and have potential as therapeutic targets and molecular markers of response to differentiating agents. [Mol Cancer Ther 2007;6(4):1300–9]

Introduction

Neuroblastic tumors are the most common extracranial tumor and account for nearly 10% of all childhood cancer. They are considered developmental tumors that arise from cells of the neural crest probably because of genetic and molecular alterations that result in arrested differentiation and uncontrolled proliferation (1). Clinically, neuroblastic tumors are heterogeneous with at least three distinct categories: tumors that present in infancy with disseminated disease that spontaneously regress or mature; local-regional tumors that rarely develop distant metastasis and, in general, carry a good prognosis; and highly lethal tumors that metastasize early, commonly to bone, and pose a difficult therapeutic challenge.

Neuroblastic tumors are also pathologically heterogeneous. Schwannian stroma-poor tumors (neuroblastoma) can be undifferentiated, or show early gangliocytic differentiation. Ganglioneuroblastomas have a mixture of immature neuroblasts, maturing ganglion cells, and Schwannian stroma. Ganglioneuromas are Schwannian stroma dominant, with mature gangliocytic and stromal components (2). It is generally true that differentiated human neuroblastic tumors are associated with better outcome and lower stage. Therefore, induction of differentiation is considered to be therapeutically advantageous, and differentiating agents such as retinoic acid (RA) have become standard clinical treatment (3, 4).

The regulation of differentiation in neuroblastic tumors is complex and poorly understood. RA is known to induce differentiation in several tumor types including neuroblastoma, and it is the most widely used differentiating therapeutic agent (5). RA is a powerful morphogen that activates nuclear hormone receptors (RA receptor and retinoid X receptor), which in turn regulate transcription of genes with RA-responsive elements. In the absence of RA, corepressive elements (SMT, N-cor, and mSin3a) inhibit transcription. The presence of RA releases corepressors and histone deacetylases, allowing for chromatin remodeling and access to specific RA-responsive elements. The cellular retinol- and RA-binding proteins (CRBP and CRABP) enhance the binding of RA to its receptors (6).

Endogenous retinoids play a critical role in normal development, and exogenous retinoids have been shown to suppress precancerous lesions and prevent the development of secondary cancers (7, 8). The potential for induction of differentiation makes RA signaling a promising molecular target for neuroblastic tumors. The critical genes and pathways regulated by RA in neuroblastic tumors are not well characterized. Identification of RA targets and their functional roles may further their utility as therapeutic targets. We used a comprehensive genomic approach to define the transcriptional program associated with RA-induced differentiation in neuroblastic tumors and its relevance to human tumors.

Materials and Methods

Cell Lines
SKN-LAI-5s (S type), SKN-BE(2)s (S type), SKN-BE(2)n (N type), SKN-BE(2)c (I type), EP1 (S type), and SH-SY5Y (N type) were kindly provided by R. Ross and B. Spengler (Fordham University, Fordham, NY). SKN-JD (I type) was derived from bone marrow metastasis from a patient with stage IV neuroblastoma at the Memorial Sloan Kettering Cancer Center, NY. Cell lines were maintained in RPMI with 10% FCS and penicillin/streptomycin at 37°C in a humidified environment with 5% CO2. To analyze the effect of RA, a final concentration of 10–5 mol/L all-trans-RA (Sigma, St. Louis, MO) was added when cells reached 60% confluence. An equivalent amount of carrier (70% ethanol) was added to controls. Morphologic differentiation of cell lines was assessed by observation using phase-contrast microscopy. Criteria for differentiation included neuritic extensions more than twice the length of the cell body, increasing adherence among neighboring cells, and denser colony aggregates (9–11).

Patient Tumor Samples
Eighty-three neuroblastic tumors consisting of stages IVS, I, II, III, IV, and IVN and ganglioneuromas were obtained during surgical resection and immediately frozen in liquid nitrogen. The frozen tissue samples were reviewed histologically, and representative tissues were dissected to provide consistent tumor content among the samples. All tumors were fully annotated with clinical and histologic features. All studies were approved by the Memorial Sloan-Kettering Cancer Center Institutional Review Board.

RNA Extraction and Transcript Analysis of Neuroblastic Tumor Cell Lines and Neuroblastic Tumors
Total RNA was extracted from frozen specimens using Trizol reagent (Life Technologies, Inc., Gaithersburg, MD) and purified with the Qiagen RNeasy System (Qiagen, Mississauga, Ontario, Canada), according to the manufacturers' instructions. Labeled nucleic acid target was hybridized (45°C for 16 h) to Affymetrix Human U95 oligonucleotide arrays as previously described (12). Expression values were calculated and normalized from the scanned array using Affymetrix Microarray Suite 5.0.

Total RNA was extracted from treated and control neuroblastic tumor cell line using the Qiagen RNeasy System (Qiagen, Valencia, CA) according to manufacturer's recommendations. RNA concentration was determined by its absorbance at 260 nm, and quality was assessed by the integrity of 28S and 18S rRNA after ethidium bromide staining of total RNA samples subjected to 1.2% agarose gel electrophoresis. Total cDNA was synthesized with a T7-polyT primer and reverse transcriptase (Superscript II, Life Technologies, Inc., Carlsbad, CA) followed by in vitro transcription with biotinylated UTP and CTP (Enzo Diagnostics, Farmingdale, NY). Labeled nucleic acid target quality was assessed by test 2 arrays and then analyzed using Affymetrix Genechip Human Genome U133 Set oligonucleotide arrays.

Antibodies and Western Blot Analysis
Twenty micrograms of each total cell protein extract was separated by electrophoresis on Nu-PAGE Novex Bis-Tris gels (Invitrogen/Life Technologies, Carlsbad, CA) and transferred to nitrocellulose membranes according to standard procedures. Incubations with antibodies to RET and phosphorylated RET (sc-167 and sc- 20252-R; Santa Cruz Biotechnology, Santa Cruz, CA) were carried out overnight at a dilution of 1:200 followed by secondary antibody for 1 h. Anti-RAN antibody (sc-1156; Santa Cruz Biotechnology) was used at a dilution of 1:200.

Quantitative Reverse Transcription-PCR
Total RNA was purified from the SKN-BE2N and SKN-BE2C cell lines. One-step real-time quantitative reverse transcription-PCR was carried out using SYBR green detection with the Bio-Rad iCycler iQ Real Time PCR Detection System (Bio-Rad LifeCycler, Hercules, CA). The primers were DUSP6, TTTACTTCTGTCTCGTCTGC and TCTGAGCGTATCTATCATGG; DHRS3, TTCGGTTTACTATTTATTGTTCGGG and CTTTCACCACCAGATAGATCATCT; PLAT, GAAGCAATCATGGATGCAAT and TGCTGGTATATCATCTGCGTTT; IGFBP6, GTCTACACCCCTAACTGCGC and GCTTGGGGTTTACTCTCCTTAG; FOXC1, AGAAGATCACCCTGAACGGC and ACATGTTGTAGGAGTCCGGG; and PLK2, GAGGGGACTCGAAGAAGAAG and ACATTTTGCAAAGCCACCCT (Sigma Proligo).

Immunohistochemistry
Multi-tissue blocks of formalin-fixed, paraffin-embedded tissues corresponding to the samples used in our study were prepared using a tissue arrayer (Beecher Instruments, Silver Spring, MD). The blocks contained three representative 0.6-mm cores from diagnostic areas of interest and control tissue. Immunohistochemical analysis of tissue sections on slides was carried out using standard streptavidin-biotin peroxidase methods.

RNA Interference
SKN-BE2N and SKN-BE2C cells were plated on 12-well plates in RPMI with 10% FCS and no antibiotics. At 60% confluence, 6 µmol/L small interfering RNA (siRNA) targeted to the RET proto-oncogene in transfection reagent and transfection medium (sc-36404, sc-29528, and sc-36868; Santa Cruz Biotechnology) was added according to manufacturer's guidelines. All-trans-RA (10–5 mol/L) was added 5 h after RET siRNA. Nonspecific siRNA was used as control under identical conditions (sc-37007; Santa Cruz Biotechnology). Cells were incubated at 37°C for 24 h and collected for Western blot analysis and RNA extraction per standard procedures. Viability was measured using the 3-(4,5 dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide colorimetric assay (American Type Culture Collection, Rockville, MD; ref. 13). Assays were done in triplicate.

Immunofluorescence
Cells were treated with RET siRNA (as previously described) and a nonspecific control siRNA (as previously described). All-trans-RA (10–5 mol/L) was added 5 h after RET siRNA. Twenty-four hours later, cells were fixed with 4% formaldehyde, blocked with 2% goat serum, and incubated with rabbit anti-ret antibody (1:200) at room temperature for 1 h. Slides were then incubated with biotinylated anti-rabbit IgG at a dilution of 1:500 for 1 h at room temperature. A fluorescent streptavidin, Alexa Fluor 594 conjugate (S-11227; Invitrogen, Carlsbad, CA) at a dilution of 1:200 was added for 1 h in the dark at room temperature. After mounting with Immu-mount (Shandon, Pittsburgh, PA), images were captured using an Axio2 Imaging wide-field fluorescence microscope.

Pharmacologic Studies
ZD6474 (Zactima) was kindly provided by AstraZeneca Pharmaceuticals UK (Chesire, United Kingdom). ZD6474 (5 µmol/L) was added to neuroblastic tumor cell lines (SH-SY5Y, SKN-BE2C, and SKN-BE2N) when they reached 60% confluence. RA was added 5 h after the drug. Neuroblastic tumor cell lines with DMSO only were used as controls. At 24 h, cells were washed with PBS, collected, and lysed with an SDS 1% cell lysis buffer (0.1 mol/L with 1 mmol/L DTT), a protease inhibitor (Halt Protease Inhibitor Cocktail kit, Pierce, Rockford, IL), and a phosphatase inhibitor (Halt Phosphatase Inhibitor Cocktail, Pierce). Morphology was imaged using phase-contrast microscopy, and protein analysis was done with Western blot.

Data Analysis
To assess the relationship between gene expression of samples, we used an average linkage hierarchical cluster algorithm in "Cluster," and results were displayed in "Treeview" software.3 The data was log 2 transformed, and genes were centered and normalized.

A Fisher's exact test was used to calculate the hypergeometric probability of overlap between specified gene lists compared against a random list sampled from all genes. The resulting P value was adjusted with a Bonferroni multiple testing correlation (Genespring 6.0 software, Silicon Genetics, Redwood City, CA; ref. 14).

Results

Transcript Changes During RA-Induced Differentiation of Neuroblastoma
To identify genes that participate in neuroblastic tumor differentiation, we treated neuroblastic tumor cell lines with all-trans-RA and monitored changes in transcript levels during the time course of differentiation. We chose seven different cell lines that represent a spectrum of neuroblastic tumor cell types (15). The N-type cell lines [SKN-BE(2)n and SH-SY5Y] have immature neuroblasts, a high nuclear to cytoplasmic ratio, fewer adherence to the substrate, and increased adherence to other cells. The S-type lines [SKN-BE(2)s, SKN-LAI-5s, and SH-EP1] are large flat cells with abundant cytoplasm that adhere to the substrate. The intermediate I-type lines [SKN-BE(2)c and SKN-JD] have morphologic features of both the N- and S-type cells. Six of the seven neuroblastic tumor cell lines showed the expected morphologic changes following treatment including neuritic extensions, increased adherence to neighboring cells, and denser colony aggregates (Fig. 1 ). Morphologic changes were evident at 12 h and were fully developed at 24 to 48 h. SKN-LAI-5s did not show convincing morphologic evidence of differentiation even after 5 days of treatment with RA, as previously reported (16).


Figure 1
View larger version (43K):
[in this window]
[in a new window]

  		Figure 1. Phase-contrast photomicrographs (x40 objective) of representative neuroblastic tumor cell lines [N type (SH-SY5Y), S type (SH-EP1), and I type (SKN-BE2C)] showing morphologic changes 24 h after treatment with RA, including increased number and length of neuritic extensions, increased adherence to neighboring cells, and denser colony aggregates. Control was addition of carrier only.

 
RNA was prepared from RA-treated and control cell lines at 0, 12, 24, and 48 h posttreatment and analyzed for transcript abundance using oligo nucleotide arrays with 22,000 probe sets. Transcript level alterations were determined by comparing the change in probe set signal intensity with RA treatment with that of control cells exposed to carrier alone. There was marked heterogeneity in the transcriptional response among the individual cell lines. This was most evident at the earliest time point with greater similarity of transcript changes detected later in the time course of the experiment. For example, at 12 h posttreatment, the number of probe sets detecting >3-fold differential expression ranged from 115 for EP1 to 8 in the unresponsive LAI-5s cell line (Table 1 ). A total of 552 probe sets detected transcript alterations of at least z3-fold in the seven cell lines at some time point in the experiment. This degree of heterogeneity in transcriptional response to RA suggested that individual cell lines have relatively unique responses to RA, although in most cases, the end result (i.e., differentiation) is similar. Cell context, therefore, seems to be an important variable for the initial phases of gene regulation by RA. Consistent with this concept, we found there was greater similarity among the three subclones of the BE(2) cell line than between different cell lines. This suggests that the unique response of an individual cell lineage to RA is maintained, although these sublines differ in cell type (N, S, and I; Fig. 2 ). There were 35 probe sets showing altered expression at 48 h common to all three BE(2) cell lines. The greatest degree of overlap was seen with SKN-BE2n and SKN-BE2s, which shared 129 probe sets detecting altered transcript levels.


View this table:
[in this window]
[in a new window]

  		Table 1. Number of genes with at least 3-fold altered expression following RA administration

 

Figure 2
View larger version (9K):
[in this window]
[in a new window]

  		Figure 2. Venn diagram of RA-regulated genes among the BE2 cell sublines showing the degree of heterogeneity within a single neuroblastic tumor cell lineage. The greatest degree of overlap was seen with SKN-BE2N and SKN-BE2S.

 
Despite the heterogeneity, a small number of genes consistently responded to RA. At 12 h, seven genes were strongly up-regulated (at least 3-fold after filtering to remove genes with low level expression) in at least four of the six responsive neuroblastoma cell lines. At 24 h, 11 genes were strongly differentially expressed in at least four cell lines, and at 48 h, 19 genes were differentially expressed (Table 2 ). Several of the transcripts that were altered after RA treatment have been previously described as regulated by retinols and serve as independent validation (6, 17–21).


View this table:
[in this window]
[in a new window]

  		Table 2. Genes (probe sets) overexpressed at least 3-fold in four of the six RA-responsive neuroblastic tumor cell lines

 
Expression of Genes that Are Regulated by RA Is Associated with Distinct, Clinically Relevant Subgroups of Human Neuroblastic Tumors
To evaluate the relevance of expression of RA-regulated genes in human neuroblastic tumors, we evaluated transcript profiles of 83 neuroblastic tumors that represent a spectrum of differentiation and stages (12). Hierarchical cluster analysis of transcript levels for the 552 genes that were differentially expressed 3-fold in the seven cell lines following RA treatment showed a strong tendency for some clinically relevant classes of neuroblastic tumors to form distinct clusters (Fig. 3 ). In particular, the profiles for stroma-poor, MYCN-amplified, stage IV neuroblastic tumors were closely correlated and distinct from the profiles of stroma-rich neuroblastic tumors. Further analysis revealed an overrepresentation of genes that are differentially expressed between MYCN-amplified and nonamplified neuroblastic tumors within the 552 RA-regulated gene set and also for genes that are differentially expressed between stroma-poor and stroma-rich neuroblastic tumors (3-fold change; Fisher's exact test, P < 0.001 for each). The strong correlation between expression of these genes and biologically distinct subclasses of human neuroblastic tumors suggests these are also relevant in vivo.


Figure 3
View larger version (65K):
[in this window]
[in a new window]

  		Figure 3. Cluster analysis of the expression profiles of 83 human neuroblastic tumors based on the 552 genes that were differentially expressed at least 3-fold in the neuroblastic tumor cell lines following RA treatment. Sample annotations are indicated. Red, stroma rich; blue, stroma poor; purple, MYCN nonamplified; green, MYCN amplified. Gene expression levels are pseudo-colored red for expression above the mean and green for expression below the mean.

 
RET Proto-oncogene Activity Is Required for RA-Induced Differentiation
The consistent altered regulation of specific genes by RA implies that these gene products are critically important for RA-induced differentiation of neuroblastic tumors. Increased expression of the RET tyrosine kinase transcript is one of the earliest and most consistent events following RA treatment of the neuroblastic tumor cell lines (Fig. 4 ). Because RET plays a crucial role in neural crest development, we asked if high levels of RET activity were necessary for differentiation to occur in neural crest–derived neuroblastic tumors.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

  		Figure 4. Gene expression levels for four representative RA-responsive genes after treatment with 10–5 mol/L all-trans-RA. Cell lines are indicated. Carrier-treated controls (blue columns) and RA-treated samples (red columns).

 
ZD6474 is a potent inhibitor of several tyrosine kinases, including vascular endothelial growth factor receptor-2, epidermal growth factor receptor, and RET (22). It has been shown to affect cell morphology and tumorigenesis by inhibition of oncogenic forms of RET (23). RET is the only one of the three receptors up-regulated after RA treatment in neuroblastic tumors, and we tested the effects of ZD6474 on RA-induced differentiation using three neuroblastic tumor cell lines (SH-SY5Y, SKN-BE2n, and SKN-BE2c). Phosphorylated RET was dramatically increased by 24 h after RA administration and decreased by treatment with ZD6474 in all three cell lines (Fig. 5 ). Furthermore, the morphologic features of differentiation that follow RA administration were markedly curtailed by ZD6474 as evidenced by decreased numbers and lengths of cellular processes. The data suggest that RET activity is required for RA-induced differentiation in neuroblastic tumor cell lines.


Figure 5
View larger version (66K):
[in this window]
[in a new window]

  		Figure 5. Treatment of neuroblastic tumor cell lines with ZD6474 down-regulated RET phosphorylation and abrogated differentiation in neuroblastic tumor cell lines. A, Western blot with anti–phosphorylated RET (p-RET). B, phase-contrast photomicrographs of neuroblastic tumor cell lines. Cell lines are indicated. C, treatment with carrier as control; RA, treatment with RA alone; ZD, treatment with ZD6474 before addition of RA.

 
Because pharmacologic inhibition with ZD6474 is not RET specific, we also used a pool of three siRNAs targeting exon 7, exon 16, and exon 19 of both isoforms of the human RET mRNA to specifically reduce RET expression (24). siRNA transfection was carried out in SKN-BE(2)n and SKN-BE(2)c because both had shown a rapid response to RA treatment with characteristic morphologic changes and increased expression of RET by 18- and 5.1-fold, respectively. RET siRNA abrogated RA induction of RET in a subset of cells as determined by immunofluorescence and Western blot (Fig. 6A and B ). The degree of RET interference approximately corresponded to the 50% transfection efficiency achieved in these cell lines with siRNA. To correlate RET expression and degree of differentiation, we randomly selected 52 cells from the treated and control group for morphometric analysis. RET expression was significantly decreased in a proportion of the cells by 24 h after treatment with RET-specific siRNA (P < 0.001; Fig. 6C). In addition, RET interference resulted in failure of RA to induce morphologic differentiation in both cell lines (Fig. 6). We used the sum of the length of neuritic extensions for each of the same 52 cells as a measure of differentiation (25, 26). There was a strong statistical difference between the RET siRNA and control siRNA treated cells with regard to the mean of the sum of neuritic extensions (100 versus 51; P < 0.001; Fig. 6D).


Figure 6
View larger version (20K):
[in this window]
[in a new window]

  		Figure 6. RET siRNA inhibition of RET expression and neuroblastic tumor cell line differentiation. A, RET immunofluorescence in SKN-BE2C cells after RA treatment (x40 objective). B, Western blot for RET protein in SKN-BE2C neuroblastic tumor cell line. C, RET immunofluorescent signal intensity for RET siRNA–treated SKN-BE2C (black columns) and control siRNA–treated cells (white columns). Y-axis, number of cells in each intensity bin; X-axis, lower limit of the signal intensity bin. D, mean length of neuritic extensions in RET siRNA–treated (black columns) and control siRNA–treated (white columns) cells. Y-axis, number of cells in each neuritic length bin; X-axis, lower limit of the average length of neuritic extensions for each bin.

 
We further asked if RET interference affected transcriptional changes associated with RA-induced differentiation. We selected six differentiation-related genes for which expression had been markedly increased by RA in our previous microarray experiment (Table 1). We evaluated DUSP6, DHRS3, FOXC1, IGFBP6, PLAT, and PLK2 transcript levels following RA administration with or without RET siRNA using quantitative reverse transcription-PCR. Two cell lines were tested (SKN-BE2C and SKN-BE2N) in triplicate with ß-actin as a control. RA-induced expression of DHRS3, PLK2, and IGFBP6 was much reduced by RET siRNA in both cell lines (P = 0.028, 0.0011, and 0.0079, respectively), whereas levels of DUSP6, FOXC1, and PLAT were unchanged (Fig. 7 ). This series of experiments suggests that RET activity mediated RA-induced expression of some genes and was required for morphologic differentiation in neuroblastic tumors.


Figure 7
View larger version (7K):
[in this window]
[in a new window]

  		Figure 7. Quantitative reverse transcription-PCR determination of transcript levels for six representative RA-responsive genes after treatment with RET-specific siRNA (white columns) and control siRNA (black columns).

 
Discussion

RA induces differentiation in many cell types and is a clinically useful therapeutic agent. Neuroblastic tumors, in particular, are well known to show dramatic neural maturation in response to RA and provide a useful model to investigate this complex process. We did a genome-wide, high-throughput molecular analysis of RA-induced differentiation in seven neuroblastic tumor cell lines and found that transcriptional responses were heterogeneous and cell context dependent. Nonetheless, there were a relatively small number of transcript alterations that were consistent across the RA-responsive cell lines. Furthermore, the expression of RA-responsive genes was associated with clinically relevant subclasses of human neuroblastic tumors and most distinct between stroma-rich and stroma-poor tumor classes. The constant RA-responsive gene products are candidates as key regulatory molecules for induction of neural differentiation. In support of this concept, the tyrosine kinase receptor RET was found to be required for RA-induced differentiation of neuroblastic tumors.

Several prior high-throughput efforts to study the effects of RA on neuroblastic tumors have been reported. Most are limited to one or two specific cell lines and used early versions of probe arrays (27, 28). A recent study used a cDNA microarray with 4,500 probes to analyze genes regulated by RA in two neuroblastoma cell lines (SKN-BE2C and SH-SY5Y; ref. 20). Several of the genes identified as altered in both cell lines were confirmed in our results. This study went on to show that many RA-induced gene expression changes also occurred in RA-treated breast and lung cancer cells. It is interesting to note that there is very limited overlap between the RA-regulated genes identified in our study and results of similar published experiments in acute promyelocytic leukemia and medulloblastoma (29, 30).

The functional roles of the RA target genes in neuroblastic tumors represent a broad spectrum. Several are believed to regulate RA activity. CRABP2 and RARB are RA-binding proteins that play a role in regulation of transcription by RA, whereas CYP26A1 and CYP26B1 are P450 cytochromes that are involved in metabolism and inactivation of RA (6). These genes are well known to be responsive to RA (20, 22, 31–34). It may be that inhibition of these key enzymes that regulate RA degradation, or activation of gene products that enhance RA activity, could potentiate RA therapeutic activity and be clinically useful (35, 36).

The mitogen-activated protein kinase (MAPK) pathway member DUSP6 was highly up-regulated by RA. MAPKs are involved in a variety of cellular processes including differentiation and proliferation (37–39). DUSP6 is a dual-specificity phosphatase that dephosphorylates phospho-threonine and phospho-tyrosine residues within MAPKs and is highly specific for extracellular signal-regulated kinase 1/2 inactivation (40). DUSP6 is located on chromosome 1p36. Loss of chromosome 1p36 is associated with poor outcome in neuroblastic tumors and is frequent in high-risk tumors (41). Allelic loss may contribute to decreased DUSP6 expression, increased extracellular signal-regulated kinase 1/2 activity, and preservation of an undifferentiated state. RA-induced expression of DUSP6 may contribute to differentiation and suggests that other extracellular signal-regulated kinase 1/2 inhibitors could have therapeutic potential.

Protein kinase C family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PRKCH is a calcium-independent and phospholipid-dependent member of the protein kinase C family that has been reported to activate MAPK13 (p38delta)–activated protein kinase cascade and the Akt-mammalian target of rapamycin signaling pathways (42). PRKCH is located on chromosome 14q22-q23. Of interest, the distal portion of chromosome 14q is frequently deleted in neuroblastic tumors, suggesting that it may harbor a tumor suppressor gene (43).

The FOXC1 transcription factor was up-regulated after RA treatment and is known to play a role in the regulation of embryonic and ocular development. Mutations in this gene cause various glaucoma phenotypes including primary congenital glaucoma, autosomal-dominant iridogoniodysgenesis anomaly, and Axenfeld-Rieger anomaly (44). There is evidence that FOXC1 functions as a tumor suppressor through transforming growth factor-ß1–mediated signals (45), and the FOX gene family is highly implicated in carcinogenesis (46).

The RET proto-oncogene encodes a receptor tyrosine kinase expressed in neural crest and urogenital precursor cells (47, 48). It is detected in many human tumors of neural crest origin and considered the causative gene for human papillary thyroid carcinoma (rearrangements), multiple endocrine neoplasias types 2A and 2B (mutations), and Hirschbrung's disease (germline mutations; refs. 49–52). RET mutations have not been identified in neuroblastic tumors (53). In rodent embryonic and adult tissues, RET is highly expressed in the enteric, sympathetic, sensory, central motor, dopamine, and adrenergic neurons, suggesting its involvement in the differentiation and survival of these neurons (45).

Many studies have concluded that RET plays a major role in differentiation and proliferation (21, 51). It participates in a reciprocal loop between stromal mesenchyme and the ureteric bud epithelium; vitamin A–dependent signals secreted by stromal cells control Ret expression in the ureteric bud. Ureteric bud signals dependent on Ret then control stromal cell patterning (54). RET expression within the differentiating metanephros may control the nephron mass (55), and increased RET expression occurs before neurite outgrowth in neuroblastic cells induced with RA (56).

Our studies further suggest that RET may be central to RA-induced differentiation in neuroblastic tumor cell lines. Phosphorylations of Y1062 and Y1096 in the tyrosine kinase domains activate RET, resulting in a variety of cellular changes, including differentiation, survival, and proliferation. Downstream signaling may involve many different pathways, including phosphatidylinositol 3-kinase/AKT, RAS/extracellular signal-regulated kinase, c-Jun NH2-terminal kinase, and p38MAPK (57, 58). We found that inactivation of RET decreased transcript levels for some of the genes that are part of a RA-induced transcriptional program and abrogated differentiation in neuroblastic tumor cell lines. We and others have found that RET mRNA and protein is primarily expressed in cells with gangliocytic differentiation in human neuroblastic tumors and normal tissue (ref. 59; data not shown). This is reflected in gene expression data where neuroblastic tumors and cell lines with extensive gangliocytic differentiation have the highest levels of RET expression, and stroma-rich tumors with a paucity of gangliocytic cells have high levels of expression only in the gangliocytic component and, therefore, a lower overall gene expression value. It is likely that RET signaling is a key component of RA-induced differentiation, and this result suggests that other genes we identified as part of the RA-induced transcriptional program may be critical elements of the process.

The synthetic retinoid cis-RA is currently used in multimodality treatment for some neuroblastoma patients (4). It is still unclear which neuroblastic tumor patients will respond to RA therapy. Sensitivity or resistance to RA therapy may depend on activation of the transcriptional programs described here, and these specific transcripts may serve as surrogate markers of potential benefit. It could be that only those tumors able to activate this program will respond to RA therapy by differentiation and, therefore, achieve a therapeutic benefit. Post-therapy transcript analysis of tumor samples may be informative and help guide therapeutic strategy.

Acknowledgments

We thank Lishi Chen, Irene Cheung, and the Pathology and Genomics core facilities of the Memorial Sloan-Kettering Cancer Center for technical assistance.

Footnotes

Grant support: NIH grant PO1CA106450.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3 http://genomewww5.stanford.edu/Microarray (M. Eisen). Back

Received 9/19/06; revised 12/ 8/06; accepted 2/26/07.

References

  1. Manohar CF, Salwen HR, Furtado MR, Cohn SL. Up-regulation of HOXC6, HOXD1, and HOXD8 homeobox gene expression in human NBT cells following chemical induction of differentiation. Tumour Biol 1996;17:34–47.[Medline]
  2. Shimada H, Ambros IM, Dehner LP, Hata J, Joshi VV, Roald B. Terminology and morphologic criteria of NBT: recommendations by the International NBT Pathology Committee. Cancer 1999;86:349–63.[CrossRef][Medline]
  3. Sidell N, Altman A, Haussler MR, Seeger RC. Effects of retinoic acid (RA) on the growth and phenotypic expression of several human neuroblastoma cell lines. Exp Cell Res 1983;148:21–30.[CrossRef][Medline]
  4. Reynolds CP, Matthay KK, Villablanca JG, Maurer BJ. Retinoid therapy of high-risk neuroblastoma. Cancer Lett 2003;197:185–92.[CrossRef][Medline]
  5. Sidell N. RA-induced growth inhibition and morphologic differentiation of human NBT cells in vitro. J Natl Cancer Inst 1982;68:589–96.[Medline]
  6. Niles RM. Signalling pathways in retinoid chemoprevention and treatment of cancer. Mutat Res 2004;555:81–96.[Medline]
  7. Pastorino U, Infante M, Maioli M, et al. Adjuvant treatment of stage I lung cancer with high-dose vitamin A. J Clin Oncol 1993;11:1216–22.[Abstract/Free Full Text]
  8. Hong WK, Benner SE, Lippman SM. Evolution of aerodigestive tract 13-cis-retinoid acid chemoprevention: the M.D. Anderson experience. Leukemia 1994;8:S33–7.
  9. Biedler JL, Helson L, Spengler BA. Morphology and growth, tumorigenicity, and cytogenetics of human NBT cells in continuous culture. Cancer Res 1973;33:2643–52.[Abstract/Free Full Text]
  10. de Bernardi B, Rogers D, Carli M, et al. Localized neuroblastoma. Surgical and pathologic staging. Cancer 1987;60:1066–72.[CrossRef][Medline]
  11. Tsokos M, Scarpa S, Ross RA, Triche TJ. Differentiation of human NBT recapitulates neural crest development. Study of morphology, neurotransmitter enzymes, and extracellular matrix proteins. Am J Pathol 1987;128:484–96.[Abstract]
  12. Alaminos M, Mora J, Cheung NK, et al. Genome-wide analysis of gene expression associated with MYCN in human neuroblastoma. Cancer Res 2003;63:4538–46.[Abstract/Free Full Text]
  13. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxic assays. J Immunol Methods 1983;65:55–63.[CrossRef][Medline]
  14. Doane AS, Danso M, Lal P, et al. An estrogen receptor-negative breast cancer subset characterized by a hormonally regulated transcriptional program and response to androgen. Oncogene 2006;25:3994–4008.[CrossRef][Medline]
  15. Ross RA, Biedler JL, Spengler BA. A role for distinct cell types in determining malignancy in human NBT cell lines and tumors. Cancer Lett 2003;197:35–9.[CrossRef][Medline]
  16. Reynolds CP, Kane DJ, Einhorn PA, et al. Response of neuroblastoma o retinoic acid in vitro and vivo. Prog Clin Biol Res 1991;366:203–11.[Medline]
  17. Redfern CP, Lovat PE, Malcolm AJ, Pearson AD. Differential effects of 9-cis and all-trans retinoic acid on the induction of retinoic acid receptor-beta and cellular retinoic acid-binding protein II in human neuroblastoma cells. Biochem J 1994;304:147–54.[Medline]
  18. Bunone G, Borrello MG, Picetti R, et al. Induction of RET proto-oncogene expression in neuroblastoma cells precedes neuronal differentiation and is not mediated by protein synthesis. Exp Cell Res 1995;7:92–9.
  19. Freemantle SJ, Kerley JS, Olsen SL, Gross RH, Spinella MJ. Developmentally-related candidate retinoic acid target genes regulated early during neuronal differentiation of human embryonal carcinoma. Oncogene 2002;21:2880–9.[CrossRef][Medline]
  20. Liu T, Bohlken A, Kuljaca S, et al. The retinoid anticancer signal: mechanisms of target gene regulation. Br J Cancer 2005;93:310–8.[CrossRef][Medline]
  21. Cerchia L, D'Alessio A, Amabile G, et al. An autocrine loop involving ret and glial cell-derived neurotrophic factor mediates retinoic Acid-induced neuroblastoma cell differentiation. Mol Cancer Res 2006;4:481–8.[Abstract/Free Full Text]
  22. Ryan AJ, Wedge SR. ZD6474-a novel inhibitor of VEGFR and EGFR tyrosine kinase activity. Br J Cancer 2005;92:S6–13.[CrossRef][Medline]
  23. Carlomagno F, Vitagliano D, Guida T, et al. ZD6474, an orally available inhibitor of KDR tyrosine kinase activity, efficiently blocks oncogenic RET kinases. Cancer Res 2002;62:7284–90.[Abstract/Free Full Text]
  24. Sawai H, Okada Y, Kazanjian K, et al. The G691S RET polymorphism increases glial cell line-derived neurotrophic factor-induced pancreatic cancer cell invasion by amplifying mitogen-activated protein kinase signaling. Cancer Res 2005;65:11536–44.[Abstract/Free Full Text]
  25. Dawson HN, Ferreira A, Eyster MV, Ghoshai N, Binder LI, Vitek MP. Inhibition of neuronal maturation in primary hippocampal neurons from tau deficient mice. J Cell Sci 2001;114:1179–87.[Abstract]
  26. Price RD, Oe T, Yamaji T, Matsuoka N. A simple, flexible, non-fluorescent system for the automated screening of neuritic outgrowth. J Biomol Screen 2006;11:155–64.[Abstract/Free Full Text]
  27. Truckenmiller ME, Vawter MP, Cheadle C, et al. Gene expression profile in early stage of retinoic-acid induced differentiation of human SH-SY5Y neuroblastoma cells. Restor Neurol Neurosci 2001;18:67–80.[Medline]
  28. Yuza Y, Agawa M, Matsuzaki M, Yamada H, Urashima M. Gene and protein expression profiling during differentiation of NBT cells triggered by 13-cis RA. J Pediatr Hematol Oncol 2003;25:715–20.[CrossRef][Medline]
  29. Yang L, Zhao H, Li SW, et al. Gene expression profiling during all-trans retinoic acid-induced cell differentiation of acute promyelocytic leukemia cells. J Mol Diagn 2003;5:212–21.[Abstract/Free Full Text]
  30. Hallahan AR, Pritchard JI, Chandraratna RA, et al. BMP-2 mediates retinoid-induced apoptosis in medulloblastoma cells through a paracrine effect. Nat Med 2003;9:1033–8.[CrossRef][Medline]
  31. Merrill RA, Ahrens JM, Kaiser ME, Federhart KS, Poon VY, Clagett-Dame M. All-trans RA-responsive genes identified in the human SH-SY5Y NBT cell line and their regulated expression in the nervous system of early embryos. Biol Chem 2004;385:605–14.[CrossRef][Medline]
  32. Taimi M, Helvig C, Wisniewski J, et al. A novel human cytochrome P450, CYP26C1, involved in metabolism of 9-cis and all-trans isomers of retinoic acid. J Biol Chem 2004;279:77–85.[Abstract/Free Full Text]
  33. Armstrong JL, Ruiz M, Boddy AV, Redfern CP, Pearson AD, Veal GJ. Increasing the intracellular availability of all-trans retinoic acid in neuroblastoma cells. Br J Cancer 2005;92:696–704.[CrossRef][Medline]
  34. Deak KL, Dickerson ME, Linney E, et al. Analysis of ALDH1A2, CYP26A1, CYP26B1, CRABP1, and CRABP2 in human neural tube defects suggests a possible association with alleles in ALDH1A2. Birth Defects Res Part A Clin Mol Teratol 2005;73:868–75.[CrossRef][Medline]
  35. McSorley LC, Daly AK. Identification of human cytochrome P450 isoforms that contribute to all-trans-retinoic acid 4-hydroxylation. Biochem Pharmacol 2000;60:517–26.[CrossRef][Medline]
  36. Yee SW, Jarno L, Gomaa MS, et al. Novel tetralone-derived retinoic acid metabolism blocking agents: synthesis and in vitro evaluation with liver microsomal and MCF-7 CYP26A1 cell assays. J Med Chem 2005;48:7123–31.[CrossRef][Medline]
  37. Cobb MH. MAP kinase pathways. Prog Biophys Mol Biol 1999;71:479–500.[CrossRef][Medline]
  38. Johnson GL, Lapadat R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 2002;298:1911–2.[Abstract/Free Full Text]
  39. Raman M, Cobb MH. MAP kinase modules: many roads home. Curr Biol 2003;13:R886–8.[CrossRef][Medline]
  40. Marchetti S, Gimond C, Chambard JC, et al. Extracellular signal-regulated kinases phosphorylate mitogen-activated protein kinase phosphatase 3/DUSP6 at serines 159 and 197, two sites critical for its proteasomal degradation. Mol Cell Biol 2005;25:854–64.[Abstract/Free Full Text]
  41. Ejeskar K, Sjoberg RM, Abel F, Kogner P, Ambros PF, Martinsson T. Fine mapping of a tumour suppressor candidate gene region in 1p36.2-3, commonly deleted in neuroblastomas and germ cell tumours. Med Pediatr Oncol 2001;36:61–6.[Medline]
  42. Aeder SE, Martin PM, Soh JW, Hussaini IM. PKC-eta mediates glioblastoma cell proliferation through the Akt and mTOR signaling pathways. Oncogene 2004;23:9062–9.[CrossRef][Medline]
  43. Thompson PM, Seifried BA, Kyemba SK, et al. Loss of heterozygosity for chromosome 14q in neuroblastoma. Med Pediatr Oncol 2001;36:28–31.[CrossRef][Medline]
  44. Berry FB, O'Neill MA, Coca-Prados M, Walter MA. FOXC1 transcriptional regulatory activity is impaired by PBX1 in a filamin A-mediated manner. Mol Cell Biol 2005;25:1415–24.[Abstract/Free Full Text]
  45. Zhou Y, Kato H, Asanoma K, et al. Identification of FOXC1 as a TGF-beta1 responsive gene and its involvement in negative regulation of cell growth. Genomics 2002;80:465–72.[CrossRef][Medline]
  46. Katoh M, Katoh M. Human FOX gene family [review]. Int J Oncol 2004;25:1495–500.[Medline]
  47. Schuchardt A, D'Agati V, Larsson-Blomberg L, Costantini F, Pachnis V. Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret. Nature 1994;367:380–3.[CrossRef][Medline]
  48. Avantaggiato V, Dathan NA, Grieco M, et al. Developmental expression of the RET proto-oncogene. Cell Growth Differ 1994;5:305–11.[Abstract]
  49. Ikeda I, Ishizaka Y, Tahira T, et al. Specific expression of the ret proto-oncogene in human NBT cell lines. Oncogene 1990;5:1291–6.[Medline]
  50. Santoro M, Rosati R, Grieco M, et al. The ret proto-oncogene is consistently expressed in human pheochromocytomas and thyroid medullary carcinomas. Oncogene 1990;5:1595–8.[Medline]
  51. Takahashi M, Buma Y, Taniguchi M. Identification of the ret proto-oncogene products in NBTand leukemia cells. Oncogene 1991;6:297–301.[Medline]
  52. Hofstra RM, Landsvater RM, Ceccherini I, et al. A mutation in the RET proto-oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullary thyroid carcinoma. Nature 1994;367:375–6.[CrossRef][Medline]
  53. Hofstra RM, Cheng NC, Hansen C, et al. No mutations found by RET mutation scanning in sporadic and hereditary neuroblastoma. Hum Genet 1996;97:362–4.[Medline]
  54. Batourina E, Gim S, Bello N, et al. Vitamin A controls epithelial/mesenchymal interactions through Ret expression. Nat Genet 2001;27:74–8.[Medline]
  55. Moreau E, Vilar J, Lelievre-Pegorier M, Merlet-Benichou C, Gilbert T. Regulation of c-ret expression by RA in rat metanephros: implication in nephron mass control. Am J Physiol 1998;275:F938–45.[Medline]
  56. Tahira T, Ishizaka Y, Itoh F, Nakayasu M, Sugimura T, Nagao M. Expression of the ret proto-oncogene in human NBT cell lines and its increase during neuronal differentiation induced by RA. Oncogene 1991;6:2333–8.[Medline]
  57. Hansford JR, Mulligan LM. Multiple Endocrine Neoplasia type 2 and RET: from neoplasia to neurogenesis. J Med Genet 2000;37:817–27.[Abstract/Free Full Text]
  58. Ichihara M, Murakumo Y, Takahashi M. RET and neuroendocrine tumors. Cancer Lett 2004;204:197–211.[CrossRef][Medline]
  59. Ikuno N, Shimokawa I, Nakamura T, Ishizaka Y, Ikeda T. Ret-oncogene expression correlates with neuronal differentiation of neuroblastic tumors. Pathol Res Pract 1995;191:92–9.[Medline]



This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
P. Beaudry, M. Nilsson, M. Rioth, D. Prox, D. Poon, L. Xu, P. Zweidler-Mckay, A. Ryan, J. Folkman, S. Ryeom, et al.
Potent antitumor effects of ZD6474 on neuroblastoma via dual targeting of tumor cells and tumor endothelium
Mol. Cancer Ther., February 1, 2008; 7(2): 418 - 424.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oppenheimer, O.
Right arrow Articles by Gerald, W. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oppenheimer, O.
Right arrow Articles by Gerald, W. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online