Molecular Cancer Therapeutics CTRC-AACR San Antonio Breast Cancer Symposium Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ostapkowicz, A.
Right arrow Articles by Spychala, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ostapkowicz, A.
Right arrow Articles by Spychala, J.
Mol Cancer Ther. 2006;5:238-245
© 2006 American Association for Cancer Research

Lipid rafts remodeling in estrogen receptor–negative breast cancer is reversed by histone deacetylase inhibitor

Anna Ostapkowicz1, Kunihiro Inai1,4, Leia Smith5, Silvia Kreda3 and Jozef Spychala1,2

1 Lineberger Comprehensive Cancer Center; 2 Department of Pharmacology; and 3 Cystic Fibrosis/Pulmonary Research and Treatment Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina; 4 Faculty of Medical Science, University of Fukui, Fukui, Japan; and 5 Seattle Genetics, Inc., Bothell, Washington

Requests form reprints: Jozef Spychala, Department of Pharmacology, University of North Carolina, MEJ Building, CB7365, Chapel Hill, NC 27599-7365. Phone: 919-493-8996; Fax: 919-493-3299. E-mail: jozekspy{at}visiscience.com


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recently, we have found dramatic overexpression of ecto-5'-nucleotidase (or CD73), a glycosylphosphatidylinositol-anchored component of lipid rafts, in estrogen receptor–negative [ER(–)] breast cancer cell lines and in clinical samples. To find out whether there is a more general shift in expression profile of membrane proteins, we undertook an investigation on the expression of selected membrane and cytoskeletal proteins in aggressive and metastatic breast cancer cells. Our analysis revealed a remarkably uniform shift in expression of a broad range of membrane, cytoskeletal, and signaling proteins in ER(–) cells. A similar change was found in two in vitro models of transition to ER(–) breast cancer: drug-resistant Adr2 and c-Jun-transformed clones of MCF-7 cells. Interestingly, similar expression pattern was observed in normal fibroblasts, suggesting the commonality of membrane determinants of invasive cancer cells with normal mesenchymal phenotype. Because a number of investigated proteins are components of lipid rafts, our results suggest that there is a major remodeling of lipid rafts and underlying cytoskeleton in ER(–) breast cancer. To test whether this broadly defined ER(–) phenotype could be reversed by treatment with differentiating agent, we treated ER(–) cells with trichostatin A, an inhibitor of histone deacetylase, and observed reversal of mesenchymal and reappearance of epithelial markers. Changes in gene and protein expression also included increased capacity to generate adenosine and altered expression profile of adenosine receptors. Thus, our results suggest that during transition to invasive breast cancer there is a significant structural reorganization of lipid rafts and underlying cytoskeleton that is reversed upon histone deacetylase inhibition. [Mol Cancer Ther 2006;5(2):238–45]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Establishment and clinical use of tumor markers that define invasive and metastatic breast carcinoma is critical for more individualized therapeutic strategies in the future. Because breast cancer is becoming an increasingly heterogeneous disease, the task of defining specific cancer cell phenotypes is especially challenging. Several individual breast cancer markers have been established for target-specific pharmacologic intervention. The clinically proven therapies include targeting estrogen receptor (ER) and progesterone receptor and more recently Erb2 and epidermal growth factor receptor (EGFR). Major differences in expression profiles of wide number of genes has been documented in ER(–) and ER(+) carcinomas (1). Both in in vitro studies and in the clinic, these differences were associated with either more motile and invasive phenotype or more aggressive course of the disease in the case of ER(–) breast carcinoma (2). Membrane proteins and associated cytoskeleton mediate the communication with the extracellular milieu and the composition of membrane proteins is critical for cell behavior in general and invasive and metastatic properties in particular.

Among different membrane microdomains, lipid rafts are one of the least understood subcellular elements. Although their lipid composition has been investigated in several studies (37), protein components were not systematically compared between invasive and noninvasive cells. Because several in vitro models of breast cancer exemplify transition to more invasive and metastatic state, we have chosen this model to study changes in lipid rafts composition after loss of ER expression. Our recent finding that ER(–) breast cancer cells express high level of ecto-5'-nucleotidase, a glycosylphosphatidylinositol-anchored protein and a marker of lipid rafts, provides an early argument for the lipid raft remodeling during transition to more aggressive breast carcinoma (8). In this study, we aimed to analyze whether there is a consistent alteration in expression of cytoskeletal membrane and lipid raft protein components across a wider population of ER(+) and ER(–) cells that would suggest a coordinate expression consistent with the motile and invasive phenotype. Within this phenotype, we also investigated the expression of genes and proteins involved in adenosine generation and signaling. Although limited by the availability of suitable antibodies, our unique focus on expressed proteins, rather than mRNA profile, allowed us to directly relate protein expression with the specific cell phenotype.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Lines
Breast cancer ER(+) cell lines MDA-MB-474, ZR-75-1, MCF-7 and negative SK-BR-3, MDA-MB-468, MDA-MB-435s, MDA-MB-231, BT-549, Hs578t, nontransformed MCF-10A, c-Jun-transformed MCF-7/c-Jun clone 2-33 and control MCF-7/neo clone 7-1, and human fibroblasts WI-38 were obtained from either Tissue Culture Facility at Lineberger Comprehensive Cancer Center/University of North Carolina, American Type Culture Collection (Manassas, VA), or developed as described before (9). The Adr2 and AdrR MCF-7 Adriamycin-resistant cell sublines were from Dr. Y.M. Rustum (Roswell Park Cancer Institute, Buffalo, NY). Cells were maintained in MEM supplemented with Eagle salts, NaPyr, nonessential amino acids, and 10% fetal bovine serum (most cell lines); in McCoy's supplemented with 15% fetal bovine serum (SK-BR-3 cells); in Leibowitz L-15 supplemented with 10% fetal bovine serum (MDA-MB-468 cells); and in mammary epithelial growth medium supplemented with bovine pituitary extract, human epidermal growth factor, insulin, hydrocortisone, and 10% fetal bovine serum (BioWhittaker medium for MCF-10A cells) in CO2/O2 atmosphere at 37°C, except for MDA-MB-468 cells that were grown at ambient atmosphere at 37°C. All media contained penicillin and streptomycin. Original cell stocks were stored in liquid nitrogen and each sample was kept in culture for no more than 15 passages.

Reagents
All general reagents were ACS or the highest purity commercially available. The following antibodies were used. Rabbit polyclonal anti-ecto-5'-nucleotidase antibodies (for Western blot) were generated as described before (10) or purchased from BD Biosciences (PharMingen, San Jose, CA; for immunofluorescence). Anti-G{alpha}s/olf sc-383, G{alpha}i-2 sc-7276, G{alpha}12 sc-409, G{alpha}13 sc-410, thy-1 sc-9163, CD24 sc-11406, Gß sc-378, Gß2 sc-380, ankyrin B (clone 2.20), cyclin D1 sc-8396, integrin ß1 sc-8978, integrin ß2 sc-6624, integrin ß3 sc-6627, ER{alpha} sc-8005, fyn sc-434, lyn sc-15, lck sc-433, c-fgr sc-130, hck sc-72, MDR1 sc-8313, N-cadherin sc-8424, OB-cadherin sc-9997, caveolin-1 sc-894, PKC{alpha} sc 8393, fascin, sc-16579, lamin B1, sc-6216, and secondary horseradish peroxidase conjugated against goat and rat IgG were from Santa Cruz (Santa Cruz, CA). E-cadherin C20820, fak F15020, integrin ß1 I41720, integrin {alpha}5 I55220, PKCß P17720, PKC{delta} P36520, PKC{theta} P15120, moesin M36820, EBP50 E83020, ezrin M36820, gelsolin G37820, and flotillin-1 F65020 antibodies were from Transduction Laboratories (Lexington, KY). Anti-CD44s 13-5500 antibody was from Zymed (San Francisco, CA). Anti-c-Yes antibody 06-514 and c-Src GD11 were from Upstate (Lake Placid, NY); rabbit anti-uPAR (399R) were from American Diagnostica, Inc. (Greenwich, CT); anti-ß-actin was from Oncogene (Boston, MA); antifilamin antibody MAB1678, integrin {alpha}v AB1930, talin MAB1676, and vimentin AB1620 were from Chemicon (Temecula, CA); and anti-intestinal alkaline phosphatase antibodies were from Biogenesis (Kingston, NH). Antibodies against cytoskeletal proteins {alpha}-smooth muscle actin (clone 1A4), cytokeratin (clone K8.13 detecting forms 1, 5, 6, 7, 8, 10, 11, and 18; clone K8.12 detecting forms 13, 15, and 16) were from Sigma (St. Louis, MO).

Lipid Raft Isolation
Cell lysates were prepared by mixing equal volumes of cell pellets with 2% Triton X-100 on ice for 1 minute and subsequent dilution twice with PBS and twice further with 35% Nycodenz [5'-(N-2,3-dihydroxypropylacetamido)-2,4,6-triiodo-N,N-bis(2,3-dihydroxypropyl)-isophtalamide] in PBS. At each step, mixing was achieved by pipetting the lysate up and down several times with Eppendorf pipettor. A modified procedure for density gradient centrifugation using Nycodenz from Sigma-Aldrich (St. Louis, MO) was used to fractionate Triton X-100–soluble and Triton X-100–insoluble membrane and cytoskeletal subdomains and complexes (11). For the purpose of centrifugation, cell lysates containing 3 to 4 mg total protein were diluted 2-fold with 35% Nycodenz. Density step gradient was generated by applying 0.5 mL aliquots of increasing concentration of Nycodenz (35%, 25%, 22.5%, 20%, lysate in 17.5%, 15%, 12%, 8%, and 4%) sequentially into Beckman (Palo Alto, CA) 13 x 51 mm polyallomer tubes. Lysates were placed in the middle of Nycodenz gradient premixed in 17.5% Nycodenz. Tubes were centrifuged at 46,000 xg for 4 hours in a Beckman 55 Ti rotor at 4°C. Following centrifugation, 0.5 mL fractions were carefully withdrawn and small pellet was resuspended in PBS containing 0.5% SDS and 1% Triton X-100 (fraction 10). Total of 10 fractions and control input lysate were analyzed for the distribution of proteins by Western blot. Typically, components of light lipid rafts and caveolae distributed into first four fractions: Soluble cell components, including cytosolic proteins, remained in fractions 5 and 6 and cytoskeleton-associated high-density fractions were distributed in fractions 7 to 9.

Western Blotting
Cell extracts, obtained by scraping cells in PBS in the presence of protein phosphatase and protease inhibitors and lysing with ice-cold 1% Triton X-100/PBS, were loaded on the SDS-PAGE at 30 µg per lane. Separated proteins were transferred onto Immobilon-P 0.45 µmol/L (Millipore, Bedford MA) polyvinylidene difluoride membrane and used for probing with specific antibodies. Two buffer systems were used during incubations with antibodies: PBS supplemented with 5% Carnation fat-free dry milk and 0.2% Tween 20 or 25 mmol/L Tris (pH 8.4) supplemented with 130 mmol/L NaCl, 5 mmol/L potassium phosphate, 5% fat-free dry milk, and 0.2% Tween 20. Blots were reused several times after mild stripping by air drying overnight at room temperature when necessary. Secondary antibodies conjugated to horseradish peroxidase and BM Chemiluminescence Western Blotting kit (Roche, Indianapolis IN) were used to develop images on Kodak (Rochester, NY) X-Mat Blue XB-1 film.

Reverse Transcription-PCR
Extraction of total RNA was done using TRI reagent from Molecular Research Center (Cincinnati, OH). Reverse transcription-PCR assays were done using Advantage RT and Titanium Taq PCR kits from Clontech BD Biosciences (Mountain View, CA). The following PCR oligonucleotides for adenosine receptor subtypes were used: A1 forward: AATTGCTGTGGACCGCTACCTC, reverse: CGACACCTTCTTGTTGAGCTG; A2a forward: TTGACCGCTACATTGCCATCCG, reverse: GAAGATCCGCAAATAGACACC; A2b forward: ACCAACTACTTCCTGGTGTCC, reverse: GCAGCTTTCATTCGTGGTTCC: A3 forward: ATCGCTGTGGACCGATACTTG, reverse: AATGCACCTGTCTCTTTGGAG. Amplification reactions were run at the following conditions: 1 minute each at 94°C, 62°C, and 72°C, total 40 cycles. The size of PCR products were as follows: AR1 344 bp, AR2a 305 bp, AR2b 374 bp, AR3 352 bp, glyceraldehyde-3-phosphate dehydrogenase 983 bp, and trypsin inhibitor 407 bp.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have done a broad survey of the expression of membrane, cytoskeletal, and signaling proteins in breast cancer cell lines that represent ER(+) and ER(–) phenotypes. The cell panel consists of well-characterized cell lines, which invasive and metastatic potential have been defined in previous studies (12, 13), thus enabling us to correlate protein expression with specific cell phenotypes. In this cell panel, MCF-10A cells is an example of nontumorigenic mammary epithelial control cells and SK-Br-3 and MDA-MB-468 represent ER(–) cells that are less tumorigenic than MDA-MB-435s, MDA-MB-231, BT-549, and Hs578t cells (12). Recently, we showed dramatic up-regulation of ecto-5'-nucleotidase, a glycosylphosphatidylinositol-anchored membrane ecto-protein, in ER(–) breast cancer cells (8). Here, we compared the expression of ecto-5'-nucleotidase with other lipid raft components, such as CD24 and alkaline phosphatase. The expression of proposed breast cancer marker CD24 concurred with the ER receptor status and was also found in SK-Br-3 and MDA-MB-468 cells. A reciprocal pattern was found for intestinal alkaline phosphatase (Fig. 1A ). The broader membrane and cytoskeletal protein survey revealed an alteration in expression of specific proteins in ER(+) and ER(–) cell lines with somewhat variable expression in SK-Br-3 and MDA-MB-468 cells (Fig. 1A). Although E-cadherin was expressed mostly in ER(+) and control cells, other adhesion receptor integrins ß1, {alpha}5, and {alpha}V; CD44; and OB-cadherin and N-cadherin tended to coexpress with ecto-5'-nucleotidase in ER(–) cells (Fig. 1B). Similarly, cytoskeletal protein vimentin and partially smooth muscle actin, in contrast to several cytokeratins, coexpressed with ecto-5'-nucleotidase in ER(–) cells. Lamin B1 expression was independent of cell type; however, {alpha}-tubulin tended to express at higher levels in more aggressive ER(–) cells (Fig. 1A). Analysis of proteins associated with cytoskeleton show that although EBP50 and gelsolin were associated with less invasive cells, fimbrin, talin, filamin, and especially fascin and moesin tended to express at higher level in more invasive breast cancer cells (not shown). Interestingly, caveolin-1 expression strongly coincided with ecto-5'-nucleotidase, further suggesting that, in addition to ecto-5'-nucleotidase lipid rafts, caveolae may have specific function in more invasive cells. Other membrane or membrane-associated signaling molecules, such as EGFR (not shown), lyn, and PKC{alpha}, also showed similar expression pattern. On the other hand, FAK, PKC{delta}, PKC{zeta}, and integrin {alpha}3 did not display cell-specific expression (not shown).


Figure 1
View larger version (57K):
[in this window]
[in a new window]
 
Figure 1. Differential expression of membrane and cytoskeletal proteins in hyperplastic MCF-10A cells and in a panel of breast cancer cell lines. A, representative cytoskeletal and lipid raft–associated proteins. eN, ecto-5'-nucleotidase; ALP, alkaline phosphatase. B, representative membrane and signaling proteins with roles in adhesion. C, representative cytoskeleton-associated proteins. Note that moesin (bottom) and ezrin (top band on the bottom panel) are detected simultaneously using M36820 antibodies from Transduction Laboratories. Cell lysates were prepared in enough quantity so different proteins could be compared using the same lysate. They were loaded onto each lane (30 µg) and processed for SDS-PAGE and Western blotting procedure as described in Materials and Methods.

 
This comprehensive analysis helped us subcategorize our breast cancer cell panel into three distinct profiles. BT474, ZR-75-1, and MCF-7 cells having epithelial and MDA-MB-435s, MDA-MB-231, BT-549, and Hs578t having more mesenchymal features. Significantly, cell lines SK-Br-3 and MDA-MB-468 fall in between: Although losing many epithelial markers, such as E-cadherin and certain cytokeratins, they did not yet acquire full set of mesenchymal features, and, as have been shown previously, are less tumorigenic (12). Interestingly, during long cell culture (>20 cell passages), we occasionally observed temporal expression of ecto-5'-nucleotidase in SK-Br or lower expression in MDA-MB-468 cells, but no change in expression in other cell lines, suggesting some intrinsic phenotypic plasticity in these particular cells. Despite their less aggressive phenotype, this could explain metastatic behavior of MDA-MB-468 cells in mouse xenograft model (14). The MCF-10A cell line, on the other hand, expresses more complex mixture of epithelial and mesenchymal markers, and thus may likely have myoepithelial origin.

To further test whether transition to ER(–) status and more invasive phenotype will show similar shift in expression profile, we used two independent in vitro models of breast cancer progression. Development of drug resistance and overexpression of c-Jun in MCF-7 cells were both shown to correlate with the loss of ER expression and transition to more invasive and tumorigenic phenotype (9, 15). Results presented in Fig. 2 show that in these two models, there is a very similar shift in expression profile to that in ER(–) cells shown in Fig. 1A-C. To further analyze whether the expression of membrane or cytoskeletal proteins may differentiate between "cancer metastatic" and normal motile phenotypes, we included in this survey lysates from normal human fibroblasts WI-38. Normal fibroblasts are commonly used to represent mesenchymal phenotype. This comparison revealed that drug-resistant, c-Jun-transformed, and all other invasive cells shown in Fig. 1A-C exhibit the expression pattern of membrane and cytoskeletal proteins that is remarkably similar to fibroblasts. In addition to data presented in Fig. 2, we observed up-regulation of Src, lyn, and EGFR and down-regulation of Lck in ER(–) cells and in fibroblasts. The expression of fimbrin and flotillin-1 did not show, however, significant variation in these cells (not shown).


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Differential expression of membrane, adhesion, cytoskeletal, and regulatory proteins in in vitro models of breast cancer progression: drug-resistant (Adr2) and c-Jun-transformed MCF-7 cells. Comparison of expression profiles with human normal fibroblasts WI38. Experimental conditions as in Fig. 1.

 
To determine which membrane, cytoskeletal, and signaling proteins were associated with lipid rafts, we used the modified density gradient centrifugation with Nycodenz (11) and used MDA-MB-231 and MCF-7 cell lysates as representative for ER(–) and ER(+) phenotypes. These two cell lines are very well characterized in previous studies and therefore are better suited for comparative analysis. Furthermore, MDA-MB-231 cells were shown to reexpress ER{alpha} and E-cadherin upon trichostatin A treatment (16), suggesting an intrinsic plasticity important for the purpose of this work. Other cell lines shown in Fig. 1, both ER(–) and ER(+), were also tested for lipid raft distribution of selected membrane proteins and the results were similar to MCF-7 and MDA-MB-231 cells (not shown). Preliminary experiments also determined that cholesterol, an important component of lipid rafts, distributed mostly with low-density fractions 2 to 4 (here defined as lipid rafts). As shown in Fig. 3A , ecto-5'-nucleotidase and flotillin-1, two independent markers of lipid rafts, were found predominantly in low-density fractions. On the other hand, {alpha}-tubulin (disassembled to monomers under low-temperature conditions) and adenosine kinase were distributed predominantly to fractions 5 to 7, which represent Triton X-100 soluble cell extracts (not shown). Vimentin, ß-actin, and lamin B1 were distributed mostly to fractions 5 to 10, which represent heavier Triton X-100–soluble and Triton X-100–insoluble (cytoskeletal) fractions of cell lysate (not shown).


Figure 3
View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. Distribution of proteins from MDA-MB-231 cells after density gradient centrifugation. A and B, analysis of proteins associated with lipid rafts and cytoskeleton in MDA-MB-231 cells. Other conditions as in Fig. 1.

 
Among signaling membrane-associated proteins, src-family members, with the exception of c-yes, distributed almost exclusively to lipid rafts (Fig. 3A). In contrast, protein kinase C{alpha} was found exclusively in soluble cell compartment and neither associated with lipid rafts nor with insoluble cytoskeleton (Fig. 3A). CD44 and G{alpha}i2, known lipid raft components, also distributed almost exclusively to lipid rafts. On the other hand, G{alpha}s and Gß2 distributed in significant part to soluble and cytoskeletal compartments (Fig. 3B). Integrin ß1, EGFR, and OB-cadherin proteins highly expressed in MDA-MB-231 cells were distributed in all three cell compartments and FAK was found only in soluble and cytoskeletal fractions. Analysis of cell lysates from ER(+) breast cancer MCF-7 cells that express very low levels of ecto-5'-nucleotidase also showed lipid raft distribution of this protein, along with glycosylphosphatidylinositol-linked CD24, src, lyn, and G{alpha}s, suggesting that this distribution is cell type independent (not shown).

Previous studies showed that histone deacetylase inhibitors caused shift in expression pattern of selective protein groups. In breast cancer cells, trichostatin A has been shown to induce the expression of ER{alpha} and E-cadherin in MDA-MB-231 cells (16, 17). Based on these data, we asked whether trichostatin A may reverse the expression of a broader range of mesenchymal proteins that define the invasive and metastatic phenotype in breast cancer cells. Our preliminary studies revealed that 0.5 µmol/L trichostatin A concentration was most effective without triggering substantial apoptosis (see also ref. 16). Treatment of MDA-MB-231 cells with trichostatin A for 48 hours caused down-regulation of ecto-5'-nucleotidase protein (Fig. 4A ). Similar result was seen with ecto-5'-nucleotidase mRNA (not shown). Other proteins that have been shown to contribute to invasive cell behavior, such as CD44 (standard form), PKC{alpha}, caveolin-1, integrins ß1 and {alpha}5, EGFR, OB-cadherin, and moesin, were all strongly down-regulated by trichostatin A. On the other hand, epithelial markers, such as cytokeratins (detectable with K8-13 antibody), E-cadherin, ER{alpha}, EBP50, and gelsolin, were up-regulated. The expression of CD24, another marker of lipid rafts in ER(+) cells, was also significantly increased. The expression of several other proteins, including lyn (not shown) and vimentin, was only slightly down-regulated; however, at 48 hours of drug treatment, there was increased incidence of apoptosis that may have masked further changes in gene expression. Along with the complete disappearance of CD44 standard form, we have noticed an appearance of a higher molecular form, probably a splice variant (18), that was also seen in untreated MDA-MB-468 cells (Fig. 1A).


Figure 4
View larger version (70K):
[in this window]
[in a new window]
 
Figure 4. A, effect of trichostatin A on the expression of selected membrane, cytoskeletal, and associated proteins in MDA-MB-231 cells. Cells were treated with 0.5 µmol/L trichostatin A for 48 h, harvested, and processed as described in Materials and Methods. Note that some Western blots were exposed much longer than shown in Fig. 1, which caused some proteins, such as cytokeratins, EBP50, or gelsolin, to be detected in control MDA-MB-231 cells. Each experiment was repeated at least twice with similar result. B, effect of trichostatin A on the expression of adenosine receptor mRNAs determined by reverse transcription-PCR (40 cycles). The sizes of PCR products are as follows: AR1 344 bp, AR2a 305 bp, AR2b 374 bp, AR3 352 bp, glyceraldehyde-3-phosphate dehydrogenase 983 bp, and trypsin inhibitor 407 bp.

 
Because ecto-5'-nucleotidase, the major adenosine-producing enzyme in epithelial cells (19), was dramatically down-regulated in ER(–) cells exposed to trichostatin A (Figs. 1A and 4A), we tested the expression of adenosine receptors in MDA-MB-231 cells treated with trichostatin A. As shown in Fig. 4B, expression of adenosine receptors was unevenly affected by trichostatin A: Although A2a and A2b were unchanged, the expression of A1 was decreased and A3 was increased during this trichostatin A–induced transition to epithelial phenotype (Fig. 4B). Thus, increased capacity to produce adenosine seem to correlate with increased signaling through A1 receptors in aggressive breast cancer cells and this feature is reversed by histone deacetylase inhibitors.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of lipid components of membranes in breast cancer cells was done previously and revealed significantly altered ratio of phospholipids (3), increased level of gangliosides, and components of lipid rafts (46) in ER(–) cells. Furthermore, increased circulating levels of gangliosides were found in breast cancer patients when compared with healthy individuals (7). Although association of few membrane and cytoskeletal proteins with the ER status were reported before, no comprehensive analysis of membrane and cytoskeletal proteins in a broad cell panel of breast cancer cells has been done thus far. Among these proteins, vimentin, EGFR, CD44, fascin, and E-cadherin were shown to be highly correlated with ER status both in breast cancer cell lines and in clinical samples (17). EGFR and vimentin were shown to coexpress in specific subset of advanced breast carcinoma distinct from both erbB2(+) and ER(+) cases (17). CD44, moesin, and fascin were also found to express at higher level in advanced breast cancer (2022). A number of functional associations between proteins that overexpress in mesenchymal cells have also been established. CD44/moesin and CD44/lyn interactions collaborate in triggering invasiveness and chemoresistance (23, 24). Vimentin and fimbrin form functional complexes in macrophages (25). Recent study found a striking correlation of CD44+ and CD24 cells derived from breast carcinoma with their tumorigenic potential (26).

Our analysis of the expression of membrane, cytoskeletal, and associated proteins in 12 breast cancer cell lines show that there is a consistent shift in expression pattern between noninvasive and invasive cell phenotypes. The use of widely characterized cell lines allowed us to directly correlate the expression pattern with well-defined specific cellular phenotypes. Remarkably, the expression profile, common to all six more aggressive cell lines (MDA-MB-435s, MDA-MB-231, BT549, Hs578t, MCF-7/Adr2, and MCF-7/c-Jun), was to large extent recapitulated in normal fibroblasts. The extent of similarities, including increased expression of signaling molecules, such as EGFR, PKC{alpha}, lyn, and G{alpha}i-2, suggests that both membrane structural proteins and a number of proteins representing regulatory circuitry has been adopted from normal mesenchymal cells. The down-regulation of EBP50 and gelsolin, two proteins independently associating with actin cytoskeleton, correlate with up-regulation of moesin, fascin, and, to a lesser extent, talin and filamin. EBP50 may associate with ERM proteins (ezrin, radixin, and moesin) and thereby regulate anchoring of lipid rafts to cytoskeleton (27). Overall, our results may provide a direct evidence for epithelial to mesenchymal transdifferentiation in breast cancer.

We found that several membrane proteins residing in lipids rafts are differentially expressed in invasive breast cancer cells, suggesting that there is a major remodeling of this membrane microdomain during breast cancer progression. Glycosylphosphatidylinositol-linked proteins are typically considered markers of lipid rafts. In our study, they show most dramatic shift in expression profile. The complete down-regulation of CD24 in ER(–) cells and the emergence of ecto-5'-nucleotidase and alkaline phosphatase most likely have physiologic consequences. CD24 is a new marker for breast and ovarian carcinoma (28, 29) that coincides with ER(+) status (30). This mucin-like heavily glycosylated protein was shown to be a ligand for P-selectin and proposed to mediate rolling in endothelium (31). On the other hand, ecto-5'-nucleotidase and alkaline phosphatase, which seem to replace CD24 during breast cancer progression, both have phosphohydrolase activity and participate in dephosphorylation of extracellular nucleotides (mostly AMPs) and generation of signaling adenosine (32). Adenosine, the product of both ecto-5'-nucleotidase and alkaline phosphatase enzymatic activities (19), acting through a family of receptors, has well-established roles in adhesion, growth regulation, vasodilation, and angiogenesis. These activities are likely to be relevant for breast cancer progression (reviewed in refs. 32, 33). Although ecto-5'-nucleotidase was also reported to participate in cell adhesion (34, 35), it is at present unclear how ecto-5'-nucleotidase would specifically contribute to invasive cell behavior. Nonetheless, increased capacity to generate adenosine on one hand, and increased expression of A1 and decreased expression of A3 on the other hand, support the view that adenosine signaling may have distinct roles in epithelial and mesenchymal cells. Recent demonstration of increased ecto-5'-nucleotidase expression and adenosine formation upon wnt-1 pathway activation further collaborate this notion (36).

Inhibitors of histone deacetylases, including trichostatin A, have potent effects on global gene expression, inhibit cell proliferation, and induce differentiation and apoptosis (3739). Although histone deacetylase inhibitors caused changes in many different cell types, mesenchymal cells were proposed to be particularly sensitive (40). In particular, previous studies have shown that MDA-MB-231 cells induced the expression of E-cadherin and ER{alpha} after treatment with histone deacetylase inhibitor trichostatin A (16). Given the known genome-wide effects of histone deacetylase inhibitors, such response suggested that trichostatin A may have induced differentiation, which in the context of mesenchymal cells may be regarded as mesenchymal to epithelial transdifferentiation. Indeed, the expression of most markers that differentiate ER(–) and ER(+) cells were affected in a reciprocal manner. Thus, our expression profiling of a broader set of membrane and cytoskeletal proteins provide a strong evidence for the mesenchymal to epithelial transdifferentiation after treatment of breast cancer cells of mesenchymal phenotype with trichostatin A. Previous studies have shown that histone deacetylase inhibitors increased the expression of metastasis suppressors, such as breast metastasis suppressor 1 (41), tissue inhibitor of metalloproteinase 3 (42), and nm23 (43) and thereby may have therapeutic activity in metastatic phase of breast and other carcinomas. In this context, our results suggest that such antimetastatic activity, at least in the subset of ER(–) breast cancer cells, may be due to the reversion of intrinsically invasive and metastatic mesenchymal phenotype.


    Acknowledgments
 
We thank Dr. Elzbieta Kulig for performing reverse transcription-PCR for this study.


    Footnotes
 
Grant support: RO1-CA34085 and Department of Defense grant DAMD17-01-1-0351.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 7/ 5/05; revised 11/29/05; accepted 12/16/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Martin KJ, Kritzman BM, Price M, et al. Linking gene expression patterns to therapeutic groups in breast cancer. Cancer Res 2000;60:2232–8.[Abstract/Free Full Text]
  2. Daidone MG, Coradini D, Martelli G, Veneroni S. Primary breast cancer in elderly woman: biological profile and relation with clinical outcome. Crit Rev Oncol Hematol 2003;45:313–25.[Medline]
  3. Le Moyec L, Tatoud R, Eugene M, et al. Cell and membrane lipid analysis by proton magnetic resonance spectroscopy in five breast cancer cell lines. Br J Cancer 1992;66:623–8.[Medline]
  4. Lavie Y, Cao H, Bursten SL, Giuliano AE, Cabot MC. Accumulation of glucosylceramides in multidrug-resistant cancer cells. J Biol Chem 1996;271:19530–6.[Abstract/Free Full Text]
  5. Nohara K, Wang F, Spiegel S. Glycosphingolipid composition of MDA-MB-231 and MCF-7 human breast cancer cell lines. Breast Cancer Res Treat 1998;48:149–57.[CrossRef][Medline]
  6. Lucci A, Cho WI, Han TY, Giuliano AE, Morton DL, Cabot MC. Glucosylceramide: a marker for multiple-drug resistant cancers. Anticancer Res 1998;18:475–80.[Medline]
  7. Wiesner DA, Sweeley CC. Circulating gangliosides of breast-cancer patients. Int J Cancer 1995;60:294–9.[Medline]
  8. Spychala J, Lazarowski E, Ostapkowicz A, Ayscue LH, Jin A, Mitchell BS. Role of estrogen receptor in the regulation of ecto-5'-nucleotidase (eN) expression and extracellular adenosine generation in breast cancer. Clin Cancer Res 2004;10:708–17.[Abstract/Free Full Text]
  9. Smith LM, Wise SC, Hendricks DT, et al. cJun overexpression in MCF-7 breast cancer cells produces a tumorigenic, invasive and hormone resistant phenotype. Oncogene 1999;18:6063–70.[CrossRef][Medline]
  10. Yegutkin GG, Henttinen T, Samburski SS, Spychala J, Jalkanen S. The evidence of two opposite, ATP-generating and ATP-consuming, extracellular pathways on endothelial and lymphoid cells. Biochem J 2002;367:121–8.[CrossRef][Medline]
  11. Hostager BS, Catlett IM, Bisghop GA. Recruitment of CD40 and tumor necrosis factor receptor-associated factors 2 and 3 to membrane microdomains during CD40 signaling. J Biol Chem 2000;275:15392–8.[Abstract/Free Full Text]
  12. Sommers CL, Byers SW, Thompson EW, Torri JA, Gelmann EP. Differentiation state and invasiveness of human breast cancer cell lines. Breast Cancer Res Treat 1994;31:325–35.[CrossRef][Medline]
  13. Zajchowski DA, Bartholdi MF, Gong Y, et al. Identification of gene expression profiles that predict the aggressive behavior of breast cancer cells. Cancer Res 2001;61:5168–78.[Abstract/Free Full Text]
  14. Walsh MD, Luckie SM, Cummings MC, Antalis TM, McGuckin MA. Heterogeneity of MUC1 expression by human breast carcinoma cell lines in vivo and in vitro. Breast Cancer Res Treat 2000;58:255–66.
  15. Vickers PJ, Dickson RB, Shoemaker R, Cowan KHA. Multidrug-resistant MCF-7 human breast cancer cell line which exhibits cross-resistance to antiestrogens and hormone-independent tumor growth in vivo. Mol Endocrinol 1988;2:886–92.[Abstract]
  16. Yang X, Ferguson AT, Nass SJ, et al. Transcriptional activation of estrogen receptor {alpha} in human breast cancer cells by histone deacetylase inhibition. Cancer Res 2000;60:6890–4.[Abstract/Free Full Text]
  17. Wilson KS, Roberts H, Leek R, Harris AL, Geradts J. Differential gene expression patterns in HER2/neu-positive and -negative breast cancer cell lines and tissues. Am J Pathol 2002;161:1171–85.[Abstract/Free Full Text]
  18. Oliferenko S, Paiha K, Harder T, et al. Analysis of CD44-containing lipid rafts: recruitment of Annexin II and stabilization by the actin cytoskeleton. J Cell Biol 1999;146:843–54.[Abstract/Free Full Text]
  19. Picher M, Burch LH, Hirsch AJ, Spychala J, Boucher RC. Ecto 5'-nucleotidase and nonspecific alkaline phosphatase. Two AMP-hydrolyzing ectoenzymes with distinct roles in human airways. J Biol Chem 2003;278:13468–79.[Abstract/Free Full Text]
  20. Kaufmann M, Heider KH, Sinn HP, von Minckwitz G, Ponta H, Herrlich P. CD44 variant exon epitopes in primary breast cancer and length of survival. Lancet 1995;345:615–9.[CrossRef][Medline]
  21. Bankfalvi A, Terpe HJ, Breukelmann D, et al. Gains and losses of CD44 expression during breast carcinogenesis and tumour progression. Histopathology 1998;33:107–16.[CrossRef][Medline]
  22. Grothey A, Hashizume R, Sahin AA, McCrea PD. Fascin, an actin-bundling protein associated with cell motility, is upregulated in hormone receptor negative breast cancer. Br J Cancer 2000;83:870–3.[CrossRef][Medline]
  23. Herrlic P, Morrison H, Sleeman J, et al. CD44 acts both as a growth- and invasiveness-promoting molecule and as a tumor-suppressing cofactor. Ann N Y Acad Sci 2000;910:106–18.[Abstract/Free Full Text]
  24. Bates RC, Edwards NS, Burns GF, Fisher DEA. CD44 survival pathway triggers chemoresistance via lyn kinase and phosphoinositide 3-kinase/Akt in colon carcinoma cells. Cancer Res 2001;61:5275–83.[Abstract/Free Full Text]
  25. Correia I, Chu D, Chou Y-H, Goldman RD, Matsudaira PT. Integrating the actin and vimentin cytoskeletons: adhesion-dependent formation of fimbrin-vimentin complexes in macrophages. J Cell Biol 1999;146:831–42.[Abstract/Free Full Text]
  26. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003;100:3983–8.[Abstract/Free Full Text]
  27. Itoh K, Sakakibara M, Yamasaki S, et al. Cutting edge: negative regulation of immune synapse formation by anchoring lipid raft to cytoskeleton through Cbp-EBP50-ERM assembly. J Immunol 2002;168:541–4.[Abstract/Free Full Text]
  28. Fogel M, Friederichs J, Zeller Y, et al. CD24 is a marker for human breast carcinoma. Cancer Lett 1999;143:87–94.[CrossRef][Medline]
  29. Kristiansen G, Denkert C, Schluns K, Dahl E, Pilarsky C, Hoauptmann S. CD24 is expressed in ovarian cancer and is a new independent prognostic marker of patient survival. Am J Pathol 2002;161:1215–21.[Abstract/Free Full Text]
  30. Schindelmann S, Windisch J, Grundmann R, Kreienberg R, Zeillinger R, Deissler H. Expression profiling of mammary carcinoma cell lines: correlation of in vitro invasiveness with expression of CD24. Tumour Biol 2002;23:139–45.[CrossRef][Medline]
  31. Aigner S, Ramos CL, Hafezi-Moghadam A, et al. CD24 mediates rolling of breast carcinoma cells on P-selectin. FASEB J 1998;12:1241–51.[Abstract/Free Full Text]
  32. Spychala J. Tumor-promoting functions of adenosine. Pharmacol Ther 2000;87:161–73.[CrossRef][Medline]
  33. Merighi S, Mirandola P, Varani K, et al. A glance at adenosine receptors: novel target for antitumor therapy. Pharmacol Ther 2003;100:31–48.[CrossRef][Medline]
  34. Airas L, Hellman J, Salmi M, et al. CD73 is involved in lymphocyte binding to the endothelium: characterization of lymphocyte-vascular adhesion protein 2 identifies it as CD73. J Exp Med 1995;182:1603–8.[Abstract/Free Full Text]
  35. Airas L, Jalkanen S. CD73 mediates adhesion of B cells to follicular dendritic cells. Blood 1996;88:1755–64.[Abstract/Free Full Text]
  36. Spychala J, Kitajewski J. Wnt and ß-catenin signaling target the expression of ecto-5'-nucleotidase and increase extracellular adenosine generation. Exp Cell Res 2004;296:99–108.[CrossRef][Medline]
  37. Sambucetti LC, Fischer DD, Zabludoff S, et al. Histone deacetylase inhibition selectively alters the activity and expression of cell cycle proteins leading to specific chromatin acetylation and antiproliferative effects. J Biol Chem 1999;274:34940–7.[Abstract/Free Full Text]
  38. Marks P, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK. Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer 2001;1:194–202.[CrossRef][Medline]
  39. Fuino L, Bali P, Wittmann S, et al. Histone deacetylase inhibitor LAQ824 down-regulates Her-2 and sensitizes human breast cancer cells to trastuzumab, taxotere, gemcitabine and epothilone B. Mol Cancer Res 2003;2:971–84.
  40. Ailenberg M, Silverman M. Differential effects of trichostatin A on gelatinase A expression in 3T3 fibroblasts and HT-1080 fibrosarcoma cells: implications for use of TSA in cancer therapy. Biochem Biophys Res Commun 2003;302:181–5.[CrossRef][Medline]
  41. Meehan WJ, Welch DR. Breast cancer metastasis suppressor 1: update. Clin Exp Metastasis 2003;20:45–50.[CrossRef][Medline]
  42. Gagnon J, Shaker S, Primeau M, Hurtubise A, Momparler RL. Interaction of 5-aza-2'-deoxycytidine and depsipeptide on antineoplastic activity and activation of 14-3-3{sigma}, E-cadherin and tissue inhibitor of metalloproteinase 3 expression in human breast carcinoma cells. Anticancer Drugs 2003;14:193–202.[CrossRef][Medline]
  43. Yasui W, Oue N, Ono S, Mitani Y, Ito R, Nakayama H. Histone acetylation and gastrointestinal carcinogenesis. Ann N Y Acad Sci 2003;983:220–31.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
E. Matteucci, E. Ridolfi, P. Maroni, P. Bendinelli, and M. A. Desiderio
c-Src/Histone Deacetylase 3 Interaction Is Crucial for Hepatocyte Growth Factor Dependent Decrease of CXCR4 Expression in Highly Invasive Breast Tumor Cells
Mol. Cancer Res., August 1, 2007; 5(8): 833 - 845.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Linden
Adenosine metabolism and cancer. Focus on "Adenosine downregulates DPPIV on HT-29 colon cancer cells by stimulating protein tyrosine phosphatases and reducing ERK1/2 activity via a novel pathway"
Am J Physiol Cell Physiol, September 1, 2006; 291(3): C405 - C406.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ostapkowicz, A.
Right arrow Articles by Spychala, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ostapkowicz, A.
Right arrow Articles by Spychala, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online