Molecular Cancer Therapeutics Molecular Diagnostics in Cancer Therapeutic Development: Fulfilling the Promise of Personalized Medicine Targeting the PI3-Kinase Pathway in Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sundaram, S.
Right arrow Articles by Gewirtz, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sundaram, S.
Right arrow Articles by Gewirtz, D. A.
Mol Cancer Ther. 2006;5:2806-2814
© 2006 American Association for Cancer Research

Research Articles: Therapeutics, Targets, and Development

QW-1624F2-2, a synthetic analogue of 1,25-dihydroxyvitamin D3, enhances the response to other deltanoids and suppresses the invasiveness of human metastatic breast tumor cells

Sujatha Sundaram1, Matthew J. Beckman3, Amandeep Bajwa3, Jeffrey Wei1, Kathleen M. Smith1, Gary H. Posner2 and David A. Gewirtz4

1 Department of Surgery, Dartmouth Medical School, Lebanon, New Hampshire; 2 Department of Chemistry, Johns Hopkins University, Baltimore, Maryland; and Departments of 3 Biochemistry and 4 Pharmacology and Toxicology and Massey Cancer Center, Virginia Commonwealth University, Richmond, Virginia

Requests for reprints: Sujatha Sundaram, Department of Surgery, Dartmouth Medical School, One Medical Center Drive, HB 7850, Lebanon, NH 03756. Phone: 603-650-5008; Fax: 603-650-4928. E-mail: Sujatha.Sundaram{at}dartmouth.edu

Abstract

The enzyme 24-hydroxylase, also known as CYP24, metabolizes 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] and is an established marker of vitamin D activity. Our studies evaluated the influence of a low-calcemic 1,25(OH)2D3 analogue, QW-1624F2-2 (QW), on the regulation of CYP24 expression in MKL-4 cells, a metastatic mammary tumor cell model. 1,25(OH)2D3 and its analogue, EB 1089, stimulated CYP24 induction at both protein and transcript levels. In contrast, QW failed to produce a sustained stimulation of CYP24, due, in large part, to a reduction in the stability of the CYP24 message. QW enhanced the capacity of 1,25(OH)2D3 and EB 1089 to inhibit tumor cell proliferation by ~2-fold. QW also blocked the sustained induction of CYP24 expression by 1,25(OH)2D3 and EB 1089, increased the potency of 1,25(OH)2D3 and EB 1089, and inhibited breast tumor cell proliferation and invasion. [Mol Cancer Ther 2006;5(11):2806–14]

Introduction

Breast cancer is the most frequently occurring cancer and is among the leading causes of deaths due to malignancy in women. A majority of breast cancer–related deaths are due to the metastatic spread of tumor cells to distant areas of the body by way of the lymphatics and general circulation. Therefore, the treatment of metastatic disease represents a continuing therapeutic challenge. The finding that the vitamin D receptor (VDR) is expressed in many types of cancer cells, including cells derived from tumors of the breast, prostate, colon, and bladder (1–9), has long generated interest in the possibility of using 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] analogues for the control of cancer.

Vitamin D, synthesized in the skin or ingested in the diet in the form of cholecalciferol, is hydroxylated at the C25 position in the liver (25-hydroxylase or CYP27A) and at the C1 position in the kidney (1{alpha}-hydroxylase or CYP27B1) to form the active metabolite 1,25(OH)2D3 (or calcitriol). The first step in the catabolism of 1,25(OH)2D3 that ultimately leads to its excretion as calcitroic acid is mediated by the enzyme 24-hydroxylase (CYP24), an enzymatic activity that is also very tightly regulated by 1,25(OH)2D3 (10, 11). In most if not all target sites, 1,25(OH)2D3 activates its own breakdown by inducing CYP24. Therefore, CYP24 is both an established marker of 1,25(OH)2D3 activity and acts to limit the time frame in which 1,25(OH)2D3 activity is expressed (12).

As indicated above, CYP24 is the key enzyme involved in the catabolism of 1,25(OH)2D3 to the less active 1,24,25-trihydroxyvitamin D3 metabolite, which is ultimately excreted as calcitroic acid (13). Albertson et al. (14) recently identified CYP24, the gene which codes for CYP24, as a candidate oncogene in clinical breast cancer samples. Townsend et al. (15) proposed that the progression of breast carcinoma is associated not only with changes in VDR expression but also with the pre-receptor control of ligand availability through local synthesis of 1,25(OH)2D3 via CYP27B1 and degradation of 1,25(OH)2D3 by CYP24. Studies conducted by other investigators have further substantiated the clinical significance of the overexpression of CYP24 in terms of poor prognosis and overall reduced survival in patients with various types of malignancies including those of prostate (16), basal cell carcinoma (17), esophageal (18), colon (19, 20), gastric adenocarcinomas (21), and non–small-cell lung carcinomas (22).

The hormonally active form of vitamin D, 1,25(OH)2D3 (calcitriol), has been shown to inhibit breast tumor cell growth, promote breast tumor cell differentiation, as well as induce apoptotic cell death (23, 24). The presence of both the 1-{alpha} and the 25-hydroxyl groups is generally thought to be essential for effective binding of the 1,25(OH)2D3 ligand to the VDR (25). It has been reported that the newly synthesized hybrid analogue QW-1624F2-2 (QW; prepared by incorporating the calcium ablating 1-hydroxymethyl alteration along with the potentiating C, D ring 16-unsaturation, side chain 24,24-difluorination, and 26,27-homologation) has potent antiproliferative effects in a skin tumor models (26, 27), indicating that growth inhibition may not require the 1-{alpha} and 25-dihydroxy groups (28). The side chain group may be binding to the nuclear VDR as a hydrogen-bond acceptor, in contrast to the hydrogen-bond donor function of the 25-OH group of natural 1,25(OH)2D3 (29). The QW compound is ~100 times less calcemic than 1,25-(OH)2D3 when administered to rats at 1 µg/kg and has the potential to block CYP24 expression. Consequently, current studies were designed to test the novel hypothesis that interference with the induction of CYP24 by QW would result in enhanced effectiveness and prolonged action of QW and/or 1,25-(OH)2D3 analogues against metastatic breast tumor cells.

Materials and Methods

Cells
Two metastatic sublines of human MCF-7 breast tumor cells were used for the current study. MKL-4 cells overexpressing the angiogenic factor fibroblast growth factor-4 and MCF7cJun cells overexpressing the proto-oncogene c-jun were kind gifts from Dr. Michael Johnson (Lombardi Cancer Center, Georgetown University, Washington, DC) and Dr. Michael Birrer (National Cancer Institute, NIH, Bethesda, MD), respectively.

Analogues
The structures of both QW and EB 1089 are provided in Fig. 1 . EB 1089 was kindly provided by Dr. Lise Binderup (Leo Pharmaceuticals, Ballerup, Denmark). As of 2005, Cougar Biotechnology, Inc. (Los Angels, CA) has obtained the license from Leo Pharmaceuticals to develop EB 1089 for clinical use in the field of oncology. The QW analogue was synthesized according to the protocol of Posner et al. (26).


Figure 1
View larger version (6K):
[in this window]
[in a new window]
  		Figure 1. Chemical structures of 1,25(OH)2D3, EB 1089, and QW.

 
RNA Isolation and Microarray Analysis
MKL-4 cells were plated and treated with solvent, EB 1089, or QW (100 nmol/L) in triplicate for up to 48 hours. Total RNA was isolated from each well separately using the Qiagen RNeasy kit and quantified by spectrophotometry. To control for biological variability, equal amounts of RNA from each of the triplicate samples per condition were pooled before the microarray analysis. Pooled RNA was then reverse transcribed into cDNA and the resulting cDNA was used for an in vitro transcription reaction to synthesize cRNA. Biotin-labeled nucleotides were incorporated into cRNA molecules during synthesis and 15 µg of biotin-labeled cRNA were hybridized onto a GeneChip Human Genome U133A array. After hybridization, the arrays were stained with streptavidin-phycoerythrin and the stained arrays were scanned using an Agilent GeneArray Scanner (Agilent Technologies, Inc., Santa Clara, CA). The fluorescent signal intensities were quantified using Affymetrix (Santa Clara, CA) MAS 5.0 software and imported into the GeneTraffic-Uno software (Iobion, Inc., La Jolla, CA) for further analysis.

Semiquantitative Reverse Transcription-PCR
cDNA was synthesized from the same pooled RNA samples used for the microarray analysis with the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA). The CYP24 primer sequences used for these studies were gcagcctagtgcagatttcc (sense) and ccagaactgttgccttgtca (antisense).

Transient Transfections and CYP24 Promoter Activity
The chrolamphenicol vector was a gift from Dr. Sylvia Christakos (University of Medicine and Dentistry of New Jersey, Newark, NJ). The pCYP24-CAT vector consisted of a promoter construct containing the rat pCYP24 promoter (–1,367 to +74). The human pCYP24 (–1,177 to –22)-LUC construct generously provided by Dr. Wesley Pike (University of Wisconsin, Madison, WI) was generated from the original 6-kb human CYP24 promoter fragment (–5,500 to –455) made by Zou et al. (30). This human CYP24 promoter fragment (–5,500 to –455) was deleted down to 1,155 bp (–1,177 to –22) in the promoterless luciferase expression vector, pLUCpl -LUC, digested with Van91I (blunted) and NsiI, and the resultant fragment subcloned into pLUCpl digested with XhoI (blunted) and PstI.

MLK-4 cells were then transfected with a construct containing either rCYP24-CAT or hCYP24-LUC promoter constructs. ß-Galactosidase was used to monitor transfection and well-to-well pipetting efficiencies. Six-well plates of 70% confluent cells were transfected with 1 µg of DNA and 5 µL of Lipofectamine (Invitrogen Corp., Carlsbad, CA) in 1 mL of serum-free DMEM:F12 per well for 24 hours before treatment. The cells were lysed and analyzed for CAT activity with [3H]chloramphenicol and n-butyryl CoA as substrate and cofactor, respectively. Reactions were incubated at 37°C overnight, acetylated [3H]chloramphenicol was extracted by the mixed xylene method, and CYP24 promoter activity was monitored by liquid scintillation counting. Specific acetylated chloramphenicol product was quantified by subtracting nonspecific chloramphenicol. The nonspecific negative control was generated in an assay conducted in the absence of the n-butyryl CoA cofactor.

For cells transfected with luciferase constructs, the luciferase assay system (Promega, Madison, WI) was used to harvest cell lysates in lysis buffer. Extracted samples were subjected to the luciferase assay in duplicate using a luminometer (Applied Biosystems TR717, Foster City, CA). The ß-galactosidase measurements were performed on Spectramax Plus 384 (Molecular Devices, Sunnyvale, CA).

CYP24 mRNA Stability
MKL-4 cells were first induced with 100 nmol/L 1,25(OH)2D3 alone (in the absence of actinomycin) for up to 24 hours, following which, solvent, QW, EB 1089, and 1,25(OH)2D3 (all at 100 nmol/L) were added to respective wells along with the mRNA synthesis inhibitor actinomycin D (1 µg/mL). RNA was then isolated from all cells at 0- to 24-hour time points using the Qiagen RNeasy kit. CYP24 mRNA was quantified using real-time quantitative PCR. A CYP24/18S ratio of cells collected at time of actinomycin D addition (0 hours) was used as a standard (set as 1) and the various time point data for the analogues were expressed relative to these levels.

CYP24 Western Blotting
Total protein was isolated from ~1 x 106 cells under the indicated treatment conditions and time points. Cells were initially washed with cold PBS and lysed with ice-cold lysis buffer containing a protease inhibitor cocktail for 30 minutes on ice and centrifuged at 14,000 x g for 15 minutes at 4°C. The supernatant was then collected and either used immediately or stored at –80°C. Protein concentration was determined using the Bio-Rad protein assay kit according to the protocol of the manufacturer. Equal amounts of protein (20 µg) were then electrophoresed using SDS-PAGE, transferred onto nitrocellulose membranes, and immunoblotted with 5% bovine serum albumin. The membranes were incubated with a CYP24 primary antibody (1:200; Cytochroma, Inc., Markham, Canada), washed, and incubated with horseradish peroxidase–conjugated secondary antibody. Following three washes, protein expression was detected using the Pierce super signal kit. Blots were then reprobed for glyceraldehyde-3-phosphate dehydrogenase to verify equal protein loading and transfer.

Cell Proliferation Assay
The metabolic capacity of cells has previously been used as an indicator of cell viability and measure of cell proliferation (31). MKL-4 cells were plated in 96-well plates at a density of 5,000 per well in 0.1 mL of DMEM containing 10% bovine serum. After 24 hours, the wells were replaced with fresh media containing 10% charcoal-stripped fetal bovine serum and various doses of QW (0, 50, 100, and 200 nmol/L) and evaluated following 72 hours of incubation. Subsequent studies evaluated the effects of 1,25(OH)2D3 and EB 1089 with or without the simultaneous addition of QW (at concentrations of 100 nmol/L each) on the proliferation of MKL-4 cells. Control cells received equivalent amount of solvent. CellTiter Blue reagent was added to each well following 24 and 72 hours of incubation to assess the metabolic capacity of the cells in terms of their capacity to reduce resazurin to resorfin. The presence of resorfin, which is pink and highly fluorescent, was determined by recording the fluorescence [560 (20)Ex/590 (10)Em] using a BioTek plate reader (BioTek Instruments, Winooski, VT). Changes in proliferation in MKL-4 cells in different treatment groups was determined by the difference in the amount of resorfin formed in the course of 48 hours.

In vitro Invasion Assay
Cells were plated on day 1 and treated with 0 to 200 nmol/L QW on day 2. Approximately 48 hours following treatment, cells were labeled with a fluorescent probe, Dil (Molecular Probes, Eugene, OR), trypsinized, counted using a hemocytometer, diluted using serum-free culture medium to 1.25 x 105 cells/mL, and applied in the rehydrated Matrigel-coated inserts of six-well invasion chambers. Medium containing the chemoattractant (fetal bovine serum) was placed in the lower chamber of the wells and the cells were allowed to migrate for ~20 hours at 37°C. Cells that migrated/invaded to the apical side of the insert were visualized using a fluorescent microscope. A count of the stained cells was later determined from multiple digital images. Data (percent invasion) are expressed as a ratio of cells invading through the Matrigel-coated membrane relative to the migration through the control membrane with no Matrigel coating. The data are further converted to an invasion index where the ratio of the invasive capacity of the treated versus untreated cells is calculated.

Results

Analogue QW Inhibits CYP24 Expression
A microarray analysis comparison of QW with EB 1089 in a metastatic subline of human MCF-7 breast tumor cells (MKL-4; ref. 32) overexpressing the angiogenic factor fibroblast growth factor-4 indicated that QW is a potent inhibitor of CYP24 expression. Microarray analysis was performed on total RNA isolated from MKL-4 cells using the Affymetrix chip H-U133A, which consists of >22,000 probe sets with ~14,500 well-characterized genes. After subtraction of background and normalization genes, treatment of MKL-4 cells with 100 nmol/L QW for 48 hours resulted in a 90% reduction of CYP24 mRNA levels compared with controls (Fig. 2A, right and inset ). In contrast, EB 1089 significantly increased CYP24 mRNA levels (Fig. 2A, left and inset). Semiquantitative reverse transcription-PCR analysis of CYP24 expression using the primer designed with Primer 3 software5 confirmed the decrease in CYP24 (Fig. 2B) where the CYP24 transcript was almost undetectable in the sample treated with QW. In confirmation of the microarray studies, Fig. 2B further shows that QW was uniquely different from the analogue EB 1089 (26), in that EB 1089 stimulated, rather than decreased, CYP24 message expression.


Figure 2
View larger version (44K):
[in this window]
[in a new window]
  		Figure 2. A, scatter plot of gene expression data for MKL-4 cells 48 h following treatment with EB 1089 or the QW analogue. Data relating to individual genes for both treatment groups are plotted using the log of nonnormalized signal intensity for vehicle-treated control (X axis) and QW analogue–treated cells (Y axis). Inset, actual signal intensities for the CYP24A1 gene of both control and analogue-treated cells. B, semiquantitative reverse transcription-PCR analysis of RNA isolated from control and QW-treated cells, confirming the Affymetrix cDNA array. Right, results of the quantification of PCR data.

 
Effects of QW on the CYP24 Promoter
To determine whether QW might be suppressing CYP24 expression at the promoter level, both rat CYP24 (Fig. 3A ) and human CYP24 reporter (Fig. 3B) constructs were used in our reporter assays. Unexpectedly, QW was found to induce, rather than suppress, CYP24 CAT and luciferase activity, similar to the effects of 1,25(OH)2D3 and EB 1089. However, as the results from the CYP24 promoter assays are limited to relatively short incubation periods of up to 5 hours with 1,25(OH)2D3, EB 1089, and QW, this could indicate that QW is acting like other D3 analogues only in terms of an initial increase in the transcription of CYP24. Taken together with the results from Fig. 2, these data suggest that QW is likely to be decreasing CYP24 mRNA stability rather than blocking its transcription.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
  		Figure 3. A, effect of 1,25(OH)2D3, EB 1089, and the QW analogue (100 nmol/L) on CYP24 promoter activity in MKL-4 cells. After transfection with the reporter constructs, cells were treated with the indicated D3 compounds for 5 h. CAT activity was then determined as described in Materials and Methods. Columns, mean of triplicate wells and CAT assay for each sample in duplicate; bars, SE. *, P < 0.05, significantly different from its respective control vector (t test). B, effects of 1,25(OH)2D3, EB 1089, and QW (100 nmol/L) on luciferase activity in MKL-4 cells transiently transfected with a human CYP24-luciferase construct. Cells were treated with 1,25(OH)2D3, EB 1089, or QW for up to 5 h and lucifrerase activity was measured using a luminometer. Columns, mean of triplicates; bars, SE; representative of multiple experiments following normalization for transfection efficiency. *, P < 0.05, significantly different from its control vector (t test).

 
To test this tentative conclusion that RNA stability might be attenuated, studies were done in cells exposed to the RNA synthesis inhibitor actinomycin D. A >5-fold difference in the CYP24 mRNA/18S ratio was observed with MKL-4 cells exposed to 1,25(OH)2D3 for 24 hours at time 0 (Fig. 4A ). Figure 4B is a representative graph showing that CYP24 mRNA was more rapidly degraded with QW treatment than with 1,25(OH)2D3 and EB 1089. The average calculated half-life of CYP24 mRNA was ~7.5 hours in the presence of 1,25(OH)2D3 alone and 4 hours in the presence of QW. By 24 hours, the levels of CYP24 message were at basal levels with either the QW analogue or 1,25(OH)2D3. The results from this study indicate that the effects of QW are likely to be mediated via a posttranscriptional mechanism affecting the message stability.


Figure 4
View larger version (13K):
[in this window]
[in a new window]
  		Figure 4. A, MKL-4 cells were treated with 100 nmol/L 1,25(OH)2D3 for up to 24 h to induce CYP24 levels (time 0) before evaluation of the effects of EB 1089, QW, and 1,25(OH)2D3 along with actinomycin D on CYP24 message. RNA was extracted at different time points and CYP24 mRNA expression was quantified using real-time PCR. B, CYP24/18S ratio of cells collected at time of actinomycin addition (0 h) was used as a standard (set at 1) and data for all three analogues were expressed relative to these levels.

 
Effect of QW on CYP24 and VDR Protein Levels
Effects of 1,25(OH)2D3 on CYP24 levels have been previously documented in many cell types (11, 33, 34). Our present analysis of the protein lysates from MKL-4 cells indicated that the CYP24 protein is transiently induced by QW between 4 and 12 hours (Fig. 5A ). In contrast, the induction of CYP24 by EB 1089 occurred earlier, within ~2 hours. Figure 5B also indicates that the induction of the CYP24 protein by QW is transient and completely reversed within 24 hours. In contrast, the induction of the CYP24 protein by EB 1089 is sustained over at least 72 hours. Of particular importance is the observation that QW attenuates the induction of CYP24 by EB 1089 (Fig. 5B).


Figure 5
View larger version (57K):
[in this window]
[in a new window]
  		Figure 5. A, early induction of CYP24 protein by QW or EB 1089 treatment (100 nmol/L) in MKL-4 lysates. B, CYP24 protein expression following treatment with QW for 24, 48, and 72 h in the presence or absence of EB 1089. The bottom bands show glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to indicate equal loading and transfer of protein per lane. VDR response to the analogues is shown separately below glyceraldehyde-3-phosphate dehydrogenase.

 
The structural modifications in QW have the potential to modify its binding affinity to the VDR as compared with 1,25(OH)2D3 (35). The results shown in Fig. 5B are consistent with QW binding to VDR and increasing its transcriptional activity (29). QW as well as EB 1089 promotes induction of the VDR within 24 hours, which persists for up to 72 hours; this observation indicates that their actions are likely to be mediated through the VDR despite the differences in binding affinity.

Influence of QW on Tumor Cell Proliferation
Previous studies conducted by us as well as other investigators have shown antiproliferative properties of 1,25(OH)2D3 and its analogues in several tumor lines (3, 36–42). Therefore, we were interested in evaluating the antiproliferative potentials of QW in the metastatic MKL-4 subline. Our initial results using various doses of QW alone, over an incubation period of 72 hours, showed a small but linear dose response effect on the proliferation of MKL-4 cells (Fig. 6A ). Figure 6B indicates that all three analogues inhibited proliferation to various degrees. What is most interesting is that QW seemed to enhance the antiproliferative effects of both EB 1089 and 1,25(OH)2D3. Whereas there was an ~80% increase in cell proliferation over the course of 48 hours with the control group, the extent of proliferation was reduced to 39 ± 9% and 20 ± 10%, respectively, by 1,25(OH)2D3 versus 1,25(OH)2D3 with QW and to 43 ± 7% and 10 ± 5%, respectively, by EB 1089 versus EB 1089 with QW. There was almost a doubling in the efficacies of the analogues in controlling the viable cell population when administered with QW, thus suggesting that QW potentiates their antiproliferative properties.


Figure 6
View larger version (13K):
[in this window]
[in a new window]
  		Figure 6. A, dose-response curve for sensitivity to QW (0–200 nmol/L) in MKL-4 cells as measured by CellTiter Blue cell viability assay. B, percent change in cell proliferation over 48 h in control cells and cells treated with 1,25(OH)2D3 or EB 1089 in the presence or absence of QW (each at 100 nmol/L).

 
The versatility of QW compound was also evident from its enhanced antiproliferative effects in MKL-4 cells when administered with conventional chemotherapeutic agents such as tamoxifen. Whereas tamoxifen alone had little or no effect on the proliferation of MKL-4 cells, QW seemed to increase its potency by >50 ± 5% when administered along with tamoxifen (data not shown).

Effects of QW on Cell Invasion
We were further interested in evaluating whether QW might affect the invasive capacity of mammary tumor cells independent of its antiproliferative effects or its capacity to enhance the efficacies of 1,25(OH)2D3 or EB 1089. We were unable to use MKL-4 cells for the purpose of this study because the invasive potential of this cell line could only be assessed by fibroblast growth factor–induced alterations in the blood vessel formation during tumor growth in vivo. Therefore, studies were conducted using another metastatic cell line, MCF7cJun cells, which overexpress the proto-oncogene c-jun (43). Unlike MKL-4 cells, MCF7cJun cells have previously been shown to be invasive in vitro (43). Western blot analysis of CYP24 protein levels in MCF7cJun cells in response to QW and other deltanoid treatment showed a similar inhibition as that observed in MKL-4 cells (data not shown). Additionally, QW treatment alone did not exhibit significant antiproliferative effects in MCF7cJun cells (data not shown).

As shown in Fig. 7 , treatment with 100 nmol/L QW decreased the invasion and migration of MCF7cJun cells by >50%. Further evaluation of the QW analogue over a concentration range of 50 to 200 nmol/L (for 48 hours) showed a clear dose response effect on the invasiveness of metastatic MCF7cJun cells (Fig. 7), whereas no significant effect was observed on the invasive potential of empty vector–transfected control clones (7-1 neo; Fig. 7, inset).


Figure 7
View larger version (13K):
[in this window]
[in a new window]
  		Figure 7. A, in vitro invasive potential of MCF7cJun cells in the presence and absence of QW. Inset, invasive potential of 7-1 neo clone (control vector). B, dose-response curve for invasive potential of MCF7cJun cells treated with varying concentrations of QW.

 
Discussion

During the course of the last decade, several hundred analogues of the active form of the hormone 1,25(OH)2D3 have been synthesized (reviewed in ref. 23). However, expression of the antitumor activity of 1,25(OH)2D3 and its analogues has generally required repetitive administration and prolonged exposure; furthermore, the use of 1,25(OH)2D3 and many of its analogues has been limited by their propensity for causing toxic hypercalcemia (23, 24, 44–47). One strategy for lowering the effective dose and prolonging the activity of 1,25(OH)2D3 and its analogues is to block their catabolism, which is mediated largely by CYP24. The current studies suggest that QW (which contains the calcium ablating 1-hydroxymethyl alterations along with the potentiating C, D ring 16-unsaturation, side chain 24,24-difluorination, and 26,27-homologation) may have the potential to interfere with CYP24-mediated catabolism.

Metabolic inactivation of 1,25(OH)2D3 in its target cells is initiated by side chain hydroxylations at the C-23, C-24, and C-26 positions. Of these hydroxylation sites, it is now accepted that the sequential oxidation and cleavage of the side chain by mitochondrial CYP24 is the major pathway by which the hormone is inactivated. Previous studies have revealed that the expression of CYP24 is induced by 1,25(OH)2D3 exclusively at the transcriptional level. It is also worth noting that the most prominent vitamin D response elements (VDRE) identified were found in the CYP24 promoter region (48). Two groups identified functional but different VDRE elements (VDRE-1 and VDRE-2) in the antisense strand of the rat CYP24 gene promoter, thus indicating the importance of CYP24 in regulating the intracellular concentration as well as the half-life of 1,25(OH)2D3 and its analogues (49–51).

Although the up-regulation of CYP24 has been studied extensively in renal tissue (12, 33, 52–54), there is little information available relating to the regulation of CYP24 in nonrenal cells. Our data suggest for the first time that whereas QW transiently increases CYP24, it subsequently leads to the relatively rapid suppression of CYP24 expression in metastatic mammary tumor cells. The transient induction of CYP24 observed with QW may relate to the fact that CYP24 is an inducible enzyme in nonrenal tissues (55). A recent report using V79 hamster cells stably overexpressing human CYP24 (56) showed that QW is at least 10 times more potent in blocking CYP24 activity than the commonly used P450 inhibitor ketoconazole.

Our experiments showed a transient up-regulation of the CYP24 protein immediately following the addition of QW in a metastatic mammary tumor cell line, indicating that the interaction of QW with the VDR is similar to that of 1,25(OH)2D3. Nevertheless, a significant reduction in the expression of the CYP24 protein was observed after ~20 hours of incubation with QW. We hypothesize that QW may initially act as a conventional 1,25(OH)2D3 analogue before expressing its CYP24 repressive function. Despite the transient up-regulation, repression of CYP24 protein levels by QW lasted for as long as 72 hours. The half-life of the CYP24 protein seemed to be affected by QW treatment, even in the presence of another 1,25(OH)2D3 analogue, EB 1089. Furthermore, QW interfered with the induction of CYP24 by EB 1089. We postulate that QW might act by blocking a functional domain on CYP24, such that the protein molecule degrades more rapidly. Alternately, QW could mediate CYP24 inhibition via activation of an as yet unidentified short-lived corepressor protein (which may cause rapid degradation of the CYP24 protein), similar to the theory postulated by Akeno et al. (57). Another possibility is that QW might influence CYP24 activity via a kinase-mediated phosphorylation site of the enzyme. Unpublished data from our laboratory on the structure of the CYP24 protein indicate the presence of tyrosine phosphorylation sites in the hydrophilic region of the molecule that may have an effect on the enzymatic activity of CYP24.

Whereas previous studies have shown that CYP24 activity is generally correlated with changes in its message expression, the regulation of CYP24 enzymatic activity has been shown to be cell type dependent (58, 59). Characterization of the transcriptional activity of CYP24 in response to 1,25(OH)2D3 and parathyroid hormone using different renal cell lines has produced paradoxical information (34, 60, 61). Nevertheless, some of these findings could be reconciled by recent studies by Zierold et al. (53), which show that parathyroid hormone effectively destabilizes the kidney CYP24 mRNA rather than affecting its transcription. Similarly, the data presented in this report suggest that QW-mediated inhibition of CYP24 activity may reflect effects on CYP24 message stability at the posttranscriptional rather than transcriptional level. At present, the possibility cannot be excluded that enzymes other than CYP24, such as CYP27, may also be influenced by QW treatment. Using our current MKL-4 cell model, we are unable to determine the effects of QW on CYP27B1 (1{alpha}-hydroxylase) because this enzyme does not seem to be present in these cells (data not shown). Additionally, the metabolic fate of QW has not yet been clarified.

Our findings suggest that QW could be used in combination with other conventional 1,25(OH)2D3 analogues or other chemotherapeutic agents to overcome the treatment resistance that is often associated with increased CYP24 expression in tumor cells. Our studies complement the recent report by Miettinen et al. (62) where CYP24 inhibition by VID400, a ketoconazole-like compound, enhanced the growth inhibitory effects of 1,25(OH)2D3 in ovarian cancer cells. Similarly, Christensen et al. (63) have reported that combined treatment of an antiestrogen with a 1,25(OH)2D3 analogue was synergistic, abrogating the development of resistance in MCF-7 breast tumor cells in vitro.

Collectively, these results indicate that the relatively hypocalcemic 1,25(OH)2D3 analogue QW blocks the induction of CYP24, increases the potency of 1,25(OH)2D3 and other analogues, and inhibits breast tumor cell proliferation and invasion; consequently, QW could be considered as a potential candidate for breast cancer adjuvant therapy by expanding the clinical usefulness of 1,25(OH)2D3 and its analogues. This is the first study to show that a synthetic deltanoid can act as a highly specific inhibitor of the CYP24 enzymatic activity in human breast tumor cells. This effect of blocking CYP24 by QW could prevent 24-hydroxylation of 1,25(OH)2D3 and its analogues, prolonging their biological lifetime and thus allowing smaller amounts to be used either alone or in combination with other chemotherapeutic agents for the effective treatment of breast cancer.

Acknowledgments

We thank Anna M. Forsman and Carol Ringelberg for their help with the microarray data analysis.

Footnotes

Grant support: U.S. Army Medical Research and Materiel Command under contract W81XWH0410736, NIH grant CA 93547, and American Institute for Cancer Research grant 02-A068-REN.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

5 Available at http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi. Back

Received 2/20/06; revised 8/29/06; accepted 9/11/06.

References

  1. Krishnan AV, Peehl DM, Feldman D. The role of vitamin D in prostate cancer. Recent Results Cancer Res 2003;164:205–21.[Medline]
  2. Krishnan AV, Peehl DM, Feldman D. Inhibition of prostate cancer growth by vitamin D: Regulation of target gene expression. J Cell Biochem 2003;88:363–71.[CrossRef][Medline]
  3. Lin R, Nagai Y, Sladek R, et al. Expression profiling in squamous carcinoma cells reveals pleiotropic effects of vitamin D3 analog EB1089 signaling on cell proliferation, differentiation, and immune system regulation. Mol Endocrinol 2002;16:1243–56.[Abstract/Free Full Text]
  4. Bortman P, Folgueira MA, Katayama ML, Snitcovsky IM, Brentani MM. Antiproliferative effects of 1,25-dihydroxyvitamin D3 on breast cells: a mini review. Braz J Med Biol Res 2002;35:1–9.[Medline]
  5. Hedlund TE, Moffatt KA, Miller GJ. Stable expression of the nuclear vitamin D receptor in the human prostatic carcinoma cell line JCA-1: evidence that the antiproliferative effects of 1{alpha},25-dihydroxyvitamin D3 are mediated exclusively through the genomic signaling pathway. Endocrinology 1996;137:1554–61.[Abstract]
  6. Kane KF, Langman MJ, Williams GR. Antiproliferative responses to two human colon cancer cell lines to vitamin D3 are differently modified by 9-cis-retinoic acid. Cancer Res 1996;56:623–32.[Abstract/Free Full Text]
  7. Zhao X, Feldman D. Regulation of vitamin D receptor abundance and responsiveness during differentiation of HT-29 human colon cancer cells. Endocrinology 1993;132:1808–14.[Abstract]
  8. Kaewsakhorn T, Kisseberth WC, Capen CC, et al. Effects of calcitriol, seocalcitol, and medium-chain triglyceride on a canine transitional cell carcinoma cell line. Anticancer Res 2005;25:2689–96.[Medline]
  9. Sahin MO, Canda AE, Yorukoglu K, et al. 1,25 Dihydroxyvitamin D(3) receptor expression in superficial transitional cell carcinoma of the bladder: a possible prognostic factor? Eur Urol 2005;47:52–7.[CrossRef][Medline]
  10. Ohyama Y, Yamasaki T. Eight cytochrome P450s catalyze vitamin D metabolism. Front Biosci 2004;9:3007–18.[Medline]
  11. Avila E, Diaz L, Halhali A, Larrea F. Regulation of 25-hydroxyvitamin D3 1{alpha}-hydroxylase, 1,25-dihydroxyvitamin D3 24-hydroxylase and vitamin D receptor gene expression by 8-bromo cyclic AMP in cultured human syncytiotrophoblast cells. J Steroid Biochem Mol Biol 2004;89–90:115–9.[CrossRef]
  12. Omdahl JL, Bobrovnikova EV, Annalora A, Chen P, Serda R. Expression, structure-function, and molecular modeling of vitamin D P450s. J Cell Biochem 2003;88:356–62.[CrossRef][Medline]
  13. Jones G, Strugnell SA, Deluca HF. Current understanding of the molecular actions of vitamin D. Physiol Rev 1998;78:1193–231.[Abstract/Free Full Text]
  14. Albertson DG, Ylstra B, Segraves R, et al. Quantitative mapping of amplicon structure by array CGH identifies CYP24 as a candidate oncogene. Nat Genet 2000;25:144–6.[CrossRef][Medline]
  15. Townsend K, Banwell CM, Guy M, et al. Autocrine metabolism of vitamin D in normal and malignant breast tissue. Clin Cancer Res 2005;11:3579–86.[Abstract/Free Full Text]
  16. Khanim FL, Gommersall LM, Wood VH, et al. Altered SMRT levels disrupt vitamin D3 receptor signalling in prostate cancer cells. Oncogene 2004;23:6712–25.[CrossRef][Medline]
  17. Mitschele T, Diesel B, Friedrich M, et al. Analysis of the vitamin D system in basal cell carcinomas (BCCs). Lab Invest 2004;84:693–702.[CrossRef][Medline]
  18. Mimori K, Tanaka Y, Yoshinaga K, et al. Clinical significance of the overexpression of the candidate oncogene CYP24 in esophageal cancer. Ann Oncol 2004;15:236–41.[Abstract/Free Full Text]
  19. Bareis P, Bises G, Bischof MG, Cross HS, Peterlik M. 25-Hydroxy-vitamin D metabolism in human colon cancer cells during tumor progression. Biochem Biophys Res Commun 2001;285:1012–7.[CrossRef][Medline]
  20. Cross HS, Kallay E, Farhan H, Weiland T, Manhardt T. Regulation of extrarenal vitamin D metabolism as a tool for colon and prostate cancer prevention. Recent Results Cancer Res 2003;164:413–25.[Medline]
  21. Weiss MM, Snijders AM, Kuipers EJ, et al. Determination of amplicon boundaries at 20q13.2 in tissue samples of human gastric adenocarcinomas by high-resolution microarray comparative genomic hybridization. J Pathol 2003;200:320–6.[CrossRef][Medline]
  22. Jones G, Ramshaw H, Zhang A, et al. Expression and activity of vitamin D-metabolizing cytochrome P450s (CYP1{alpha} and CYP24) in human nonsmall cell lung carcinomas. Endocrinology 1999;140:3303–10.[Abstract/Free Full Text]
  23. Hansen CM, Binderup L, Hamberg KJ, Carlberg C. Vitamin D and cancer: effects of 1,25(OH)2D3 and its analogues on growth control and tumorigenesis. Front Biosci 2001;6:D820–48.[Medline]
  24. Hansen CM, Hamberg KJ, Binderup E, Binderup L. Seocalcitol (EB 1089): a vitamin D analogue of anti-cancer potential. Background, design, synthesis, pre-clinical and clinical evaluation. Curr Pharm Des 2000;6:803–28.[Medline]
  25. Peleg S, Posner GH. Vitamin D analogues as modulators of vitamin D receptor action. Curr Top Med Chem 2003;3:1555–72.[CrossRef][Medline]
  26. Posner GH, Lee JK, Wang Q, et al. Noncalcemic, antiproliferative, transcriptionally active, 24-fluorinated hybrid analogues of the hormone 1{alpha},25-dihydroxyvitamin D3. Synthesis and preliminary biological evaluation. J Med Chem 1998;41:3008–14.[CrossRef][Medline]
  27. Dixon KM, Deo SS, Wong G, et al. Skin cancer prevention: a possible role of 1,25dihydroxyvitamin D3 and its analogs. J Steroid Biochem Mol Biol 2005;97:137–43.[CrossRef][Medline]
  28. Kensler TW, Dolan PM, Gange SJ, et al. Conceptually new deltanoids (vitamin D analogs) inhibit multistage skin tumorigenesis. Carcinogenesis 2000;21:1341–5.[Abstract/Free Full Text]
  29. Posner GH, Wang Q, Han G, et al. Conceptually new sulfone analogues of the hormone 1{alpha},25-dihydroxyvitamin D(3): synthesis and preliminary biological evaluation. J Med Chem 1999;42:3425–35.[CrossRef][Medline]
  30. Zou A, Elgort MG, Allegretto EA. Retinoid X receptor (RXR) ligands activate the human 25-hydroxyvitamin D3-24-hydroxylase promoter via RXR heterodimer binding to two vitamin D-responsive elements and elicit additive effects with 1,25-dihydroxyvitamin D3. J Biol Chem 1997;272:19027–34.[Abstract/Free Full Text]
  31. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65:55–63.[CrossRef][Medline]
  32. McLeskey SW, Zhang L, Kharbanda S, et al. Fibroblast growth factor overexpressing breast carcinoma cells as models of angiogenesis and metastasis. Breast Cancer Res Treat 1996;39:103–17.[CrossRef][Medline]
  33. Zierold C, Reinholz GG, Mings JA, Prahl JM, DeLuca HF. Regulation of the procine 1,25-dihydroxyvitamin D3-24-hydroxylase (CYP24) by 1,25-dihydroxyvitamin D3 and parathyroid hormone in AOK-B50 cells. Arch Biochem Biophys 2000;381:323–7.[CrossRef][Medline]
  34. Armbrecht HJ, Hodam TL, Boltz MA, et al. Induction of the vitamin D 24-hydroxylase (CYP24) by 1,25-dihydroxyvitamin D3 is regulated by parathyroid hormone in UMR106 osteoblastic cells. Endocrinology 1998;139:3375–81.[Abstract/Free Full Text]
  35. Posner GH, Halford BA, Peleg S, Dolan P, Kensler TW. Conceptually new low-calcemic oxime analogues of the hormone 1{alpha},25-dihydroxyvitamin D(3): synthesis and biological testing. J Med Chem 2002;45:1723–30.[CrossRef][Medline]
  36. Chaudhry M, Sundaram S, Gennings C, Carter H, Gewirtz DA. The vitamin D3 analog, ILX-23-7553, enhances the response to Adriamycin and irradiation in MCF-7 breast tumor cells. Cancer Chemother Pharmacol 2001;47:429–36.[CrossRef][Medline]
  37. Sundaram S, Chaudhry M, Reardon D, Gupta M, Gewirtz DA. The vitamin D3 analog EB 1089 enhances the antiproliferative and apoptotic effects of Adriamycin in MCF-7 breast tumor cells. Breast Cancer Res Treat 2000;63:1–10.[CrossRef][Medline]
  38. Sundaram S, Gewirtz DA. The vitamin D3 analog EB 1089 enhances the response of human breast tumor cells to radiation. Radiat Res 1999;152:479–86.[Medline]
  39. Amir H, Karas M, Giat J, et al. Lycopene and 1,25-dihydroxyvitamin D3 cooperate in the inhibition of cell cycle progression and induction of differentiation in HL-60 leukemic cells. Nutr Cancer 1999;33:105–12.[Medline]
  40. Banwell CM, Singh R, Stewart PM, Uskokovic MR, Campbell MJ. Antiproliferative signalling by 1,25(OH)2D3 in prostate and breast cancer is suppressed by a mechanism involving histone deacetylation. Recent Results Cancer Res 2003;164:83–98.[Medline]
  41. Hisatake J, O'Kelly J, Uskokovic MR, Tomoyasu S, Koeffler HP. Novel vitamin D(3) analog, 21-(3-methyl-3-hydroxy-butyl)-19-nor D(3), that modulates cell growth, differentiation, apoptosis, cell cycle, and induction of PTEN in leukemic cells. Blood 2001;97:2427–33.[Abstract/Free Full Text]
  42. Tanaka Y, Wu AY, Ikekawa N, et al. Inhibition of HT-29 human colon cancer growth under the renal capsule of severe combined immunodeficient mice by an analogue of 1,25-dihydroxyvitamin D3, DD-003. Cancer Res 1994;54:5148–53.[Abstract/Free Full Text]
  43. Smith LM, Wise SC, Hendricks DT, et al. cJun overexpression in MCF-7 breast cancer cells produces a tumorigenic, invasive and hormone resistant phenotype. Oncogene 1999;18:6063–70.[CrossRef][Medline]
  44. Brown AJ. Therapeutic uses of vitamin D analogues. Am J Kidney Dis 2001;38:S3–19.[Medline]
  45. Ly LH, Zhao XY, Holloway L, Feldman D. Liarozole acts synergistically with 1{alpha},25-dihydroxyvitamin D3 to inhibit growth of DU 145 human prostate cancer cells by blocking 24-hydroxylase activity. Endocrinology 1999;140:2071–6.[Abstract/Free Full Text]
  46. Rashid SF, Moore JS, Walker E, et al. Synergistic growth inhibition of prostate cancer cells by 1{alpha},25 dihydroxyvitamin D(3) and its 19-nor-hexafluoride analogues in combination with either sodium butyrate or trichostatin A. Oncogene 2001;20:1860–72.[CrossRef][Medline]
  47. Skowronski RJ, Peehl DM, Feldman D. Vitamin D and prostate cancer: 1,25 dihydroxyvitamin D3 receptors and actions in human prostate cancer cell lines. Endocrinology 1993;132:1952–60.[Abstract]
  48. DeLuca HF. Overview of general physiologic features and functions of vitamin D. Am J Clin Nutr 2004;80:1689–96S.
  49. Zierold C, Darwish HM, DeLuca HF. Two vitamin D response elements function in the rat 1,25-dihydroxyvitamin D 24-hydroxylase promoter. J Biol Chem 1995;270:1675–8.[Abstract/Free Full Text]
  50. Chen KS, DeLuca HF. Cloning of the human 1{alpha},25-dihydroxyvitamin D-3 24-hydroxylase gene promoter and identification of two vitamin D-responsive elements. Biochim Biophys Acta 1995;1263:1–9.[Medline]
  51. Kerry DM, Dwivedi PP, Hahn CN, et al. Transcriptional synergism between vitamin D-responsive elements in the rat 25-hydroxyvitamin D3 24-hydroxylase (CYP24) promoter. J Biol Chem 1996;271:29715–21.[Abstract/Free Full Text]
  52. Yang W, Friedman PA, Kumar R, et al. Expression of 25(OH)D3 24-hydroxylase in distal nephron: coordinate regulation by 1,25(OH)2D3 and cAMP or PTH. Am J Physiol 1999;276:E793–805.[Medline]
  53. Zierold C, Mings JA, DeLuca HF. Regulation of 25-hydroxyvitamin D3-24-hydroxylase mRNA by 1,25-dihydroxyvitamin D3 and parathyroid hormone. J Cell Biochem 2003;88:234–7.[CrossRef][Medline]
  54. Gao XH, Dwivedi PP, Omdahl JL, Morris HA, May BK. Calcitonin stimulates expression of the rat 25-hydroxyvitamin D3-24-hydroxylase (CYP24) promoter in HEK-293 cells expressing calcitonin receptor: identification of signaling pathways. J Mol Endocrinol 2004;32:87–98.[Abstract]
  55. Beckman MJ, DeLuca HF. Regulation of renal vitamin D receptor is an important determinant of 1{alpha},25-dihydroxyvitamin D(3) levels in vivo. Arch Biochem Biophys 2002;401:44–52.[CrossRef][Medline]
  56. Posner GH, Jeon HB, Sarjeant A, et al. Low-calcemic, efficacious, 1{alpha},25-dihydroxyvitamin D3 analog QW-1624F2-2: calcemic dose-response determination, preclinical genotoxicity testing, and revision of A-ring stereochemistry. Steroids 2004;69:757–62.[CrossRef][Medline]
  57. Akeno N, Saikatsu S, Kawane T, Horiuchi N. Mouse vitamin D-24-hydroxylase: molecular cloning, tissue distribution, and transcriptional regulation by 1{alpha},25-dihydroxyvitamin D3. Endocrinology 1997;138:2233–40.[Abstract/Free Full Text]
  58. Armbrecht HJ, Chen ML, Hodam TL, Boltz MA. Induction of 24-hydroxylase cytochrome P450 mRNA by 1,25-dihydroxyvitamin D and phorbol esters in normal rat kidney (NRK-52E) cells. J Endocrinol 1997;153:199–205.[Abstract]
  59. Armbrecht HJ, Hodam TL. Parathyroid hormone and 1,25-dihydroxyvitamin D synergistically induce the 1,25-dihydroxyvitamin D-24-hydroxylase in rat UMR-106 osteoblast-like cells. Biochem Biophys Res Commun 1994;205:674–9.[CrossRef][Medline]
  60. Armbrecht HJ, Hodam TL, Boltz MA. Hormonal regulation of 25-hydroxyvitamin D3-1{alpha}-hydroxylase and 24-hydroxylase gene transcription in opossum kidney cells. Arch Biochem Biophys 2003;409:298–304.[CrossRef][Medline]
  61. Armbrecht HJ, Wongsurawat N, Zenser TV, Davis BB. Differential effects of parathyroid hormone on the renal 1,25-dihydroxyvitamin D3 and 24,25-dihydroxyvitamin D3 production of young and adult rats. Endocrinology 1982;111:1339–44.[Abstract]
  62. Miettinen S, Ahonen MH, Lou YR, et al. Role of 24-hydroxylase in vitamin D3 growth response of OVCAR-3 ovarian cancer cells. Int J Cancer 2004;108:367–73.[CrossRef][Medline]
  63. Christensen GL, Jepsen JS, Fog CK, Christensen IJ, Lykkesfeldt AE. Sequential versus combined treatment of human breast cancer cells with antiestrogens and the vitamin D analogue EB1089 and evaluation of predictive markers for vitamin D treatment. Breast Cancer Res Treat 2004;85:53–63.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
J. Tan, P. P. Dwivedi, P. Anderson, B. K. Nutchey, P. O'Loughlin, H. A. Morris, B. K. May, A. Ferrante, and C. S. Hii
Antineoplastic agents target the 25-hydroxyvitamin D3 24-hydroxylase messenger RNA for degradation: implications in anticancer activity
Mol. Cancer Ther., December 1, 2007; 6(12): 3131 - 3138.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sundaram, S.
Right arrow Articles by Gewirtz, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sundaram, S.
Right arrow Articles by Gewirtz, D. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online