Molecular Cancer Therapeutics Chemical and Biological Aspects of Inflammation and Cancer Targeting the PI3-Kinase Pathway in Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bottone, F. G.
Right arrow Articles by Eling, T. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bottone, F. G., Jr.
Right arrow Articles by Eling, T. E.
Mol Cancer Ther. 2005;4:693-703
© 2005 American Association for Cancer Research

The anti-invasive activity of cyclooxygenase inhibitors is regulated by the transcription factor ATF3 (activating transcription factor 3)

Frank G. Bottone, Jr.1, Yuseok Moon1, Jong Sik Kim1, Brenda Alston-Mills2, Minako Ishibashi1 and Thomas E. Eling1

1 Laboratory of Molecular Carcinogenesis, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, North Carolina and 2 Department of Animal Sciences, North Carolina State University, Raleigh, North Carolina

Requests for reprints: Thomas Eling, Laboratory of Molecular Carcinogenesis, National Institute of Environmental Health Sciences, NIH, P.O. Box 12233, 111 T.W. Alexander Drive, Research Triangle Park, NC 27709. Phone: 919-541-3911; Fax: 919-541-0146. E-mail: Eling{at}niehs.nih.gov


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously showed that nonsteroidal anti-inflammatory drugs (NSAID) such as sulindac sulfide, which has chemopreventive activity, modulate the expression of several genes detected by microarray analysis. Activating transcription factor 3 (ATF3) was selected for further study because it is a transcription factor involved in cell proliferation, apoptosis, and invasion, and its expression is repressed in human colorectal tumors as compared with normal adjacent tissue. In this report, we show that ATF3 mRNA and protein expression are up-regulated in HCT-116 human colorectal cancer cells following treatment with NSAIDs, troglitazone, diallyl disulfide, and resveratrol. To ascertain the biological significance of ATF3, we overexpressed full-length ATF3 protein in the sense and antisense orientations. Overexpression of ATF3 in the sense orientation decreased focus formation in vitro and reduced the size of mouse tumor xenografts by 54% in vivo. Conversely, overexpression of antisense ATF3 was protumorigenic in vitro, however, not in vivo. ATF3 in the sense orientation did not modulate apoptosis, indicating another mechanism is involved. With microarray analysis, several genes relating to invasion and metastasis were identified by ATF3 overexpression and were confirmed by real-time reverse transcription-PCR, and several of these genes were modulated by sulindac sulfide, which inhibited invasion in these cells. Furthermore, overexpression of ATF3 inhibited invasion to a similar degree as sulindac sulfide treatment, whereas antisense ATF3 increased invasion. In conclusion, ATF3 represents a novel mechanism in which NSAIDs exert their anti-invasive activity, thereby linking ATF3 and its gene regulatory activity to the biological activity of these compounds.

Key Words: Colorectal cancer • NSAIDs • Cyclooxygenase • ATF3


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the United States, colorectal cancer is the third leading cause of cancer with an estimated 130,000 new cases and 56,000 deaths in 2000 (1). Numerous animal studies, population-based studies, and in vitro studies with human colorectal carcinoma cells provide evidence that nonsteroidal anti-inflammatory drugs (NSAID) have chemopreventive activity directed against colorectal cancer as illustrated in a recent review (2). The traditional NSAID sulindac sulfide, particularly in colon (3, 4) and indomethacin in mammary cancers (5, 6), is well known for its ability to inhibit tumor formation in animal models, whereas the cyclooxygenase (Cox)-specific inhibitors SC-58125 (7) and SC-560 (8) have been more recently reported to inhibit the formation of tumors. Chronic NSAID use has a chemopreventive effect in colorectal and other cancers based on several population-based studies as reviewed by Giardiello et al. (9) and recently confirmed in two large, randomized clinical trials (10, 11). However, the mode of action responsible for these effects is poorly understood. NSAIDs are potent inhibitors of Cox, the enzyme responsible for the formation of prostaglandins from arachidonic acid, and are used to treat familial adenomatous polyposis, a genetic disorder resulting in abnormal colorectal polyp formation, in humans (12). Until recently, the mode of action of NSAID was thought to be solely through inhibition of Cox, which, along with its products such as prostaglandin E2, is up-regulated in tumors and enhances the invasion of cancer cells via matrix metalloproteinase-2 (MMP-2; ref. 13). However, the chemopreventive effects of these compounds may also occur, in part, through gene modulation. For example, NSAIDs such as sulindac and aspirin inhibit invasion via suppression of MMP-2 expression (14, 15), indicating a possible biological role of gene regulation by these compounds. The Cox-2–specific inhibitor celecoxib has antiangiogenic and antimetastatic activities via suppression of the transcription factor Sp1 in pancreatic cancer (16). Sulindac sulfide has well-documented chemopreventive activity whereas the Cox-1–specific inhibitor SC-560 has been more recently considered as an antitumorigenic (8), anti-invasive (17), and antimetastatic agent (18). Furthermore, several dietary compounds, including the naturally occurring Cox inhibitors resveratrol and curcumin, have antitumorigenic activity as illustrated in a recent review on the prevention of breast cancer (19). For example, diallyl disulfide (20) and resveratrol (21) have antitumorigenic activity in mouse xenograft models of tumorigenicity. Resveratrol is a phenolic compound, found in red wine and various fruits and vegetables, which has anticancer properties and modulated the expression of the antitumorigenic genes p53 and NSAID activated gene 1 (NAG-1; ref. 22). Diallyl disulfide is a constituent of garlic oil with antitumorigenic activity (23) associated with a protective effect against various cancers, such as stomach (24), and a reduction in colorectal polyps in humans (25). Like resveratrol, diallyl disulfide also modulates the expression of p53 and NAG-1 (26). Troglitazone also has antitumorigenic activity (27) and regulates NAG-1 expression via the early growth response gene 1, Egr-1 (28). Therefore, in addition to NSAIDs, a wide variety of drugs and dietary compounds are recognized for their chemopreventive and gene regulatory activity, indicating multiple, complex mechanisms are likely involved.

Our laboratory has identified several candidate genes that may account for the chemopreventive effects of NSAIDs (29). One such gene, activating transcription factor 3 (ATF3), is a transcription factor that acts as both an inducer and repressor of transcription for genes such as gadd153/Chop10, which is associated with cell growth (30), and MMP-2, which is associated with invasion (3133). Furthermore, ATF3 is induced by a variety of NSAIDs (traditional, Cox-1 selective, and Cox-2 selective), in a variety of colorectal cancer cell lines, by various dietary (34) and pharmaceutical compounds with anticancer activity such as the microtubule-binding agents colchicine and taxol (35), and the topoisomerase inhibitor etoposide (36) by a wide variety of mechanisms. Also, the expression of ATF3 is repressed in colorectal as compared with normal adjacent tissue (29), indicating it may be involved in the tumorigenic process.

In this report, we examine the ability of various dietary and pharmaceutical compounds with known cancer chemopreventive activity to regulate ATF3 in colorectal and other cancer cell lines. We show for the first time that overexpression of full-length ATF3 protein in colorectal cancer cells has antitumorigenic properties, as determined by a mouse xenograft model of tumorigenicity and focus formation assays, and decreases tumor cell invasion, whereas antisense cells have the opposite effect, indicating an antitumorigenic role for ATF3. Therefore, our data provide a novel mechanism for the chemopreventive activity of NSAIDs and perhaps other chemopreventive compounds.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals
Chemicals were purchased from Sigma Chemical Company (St. Louis, MO) unless otherwise noted. SC-560, SC-58125, and sulindac sulfide were from Cayman Chemical Company (Ann Arbor, MI), and troglitazone, etoposide, and resveratrol were from Calbiochem (San Diego, CA) and were dissolved in DMSO and prepared fresh weekly.

Tissue Culture
Cell lines were purchased from American Type Culture Collection (Manassas, VA) and maintained at 37°C/5% CO2, supplemented with 10% fetal bovine serum (complete media) and 10 mg/mL gentamicin unless otherwise indicated. Human HCT-116 were maintained in McCoy's 5A medium. Cells were treated with the compound indicated or vehicle, DMSO in serum-free medium, unless otherwise indicated. MCF-7 cells were maintained in Eagle's MEM supplemented with 1 mmol/L sodium pyruvate and 2 mmol/L L-glutamine. PC-3 cells were maintained in RPMI 1640 plus 1 mmol/L L-glutamine, 1 mmol/L sodium pyruvate, and 10 mmol/L HEPES. U87MG cells were maintained in Eagle's MEM plus 1 mmol/L L-glutamine and 1 mmol/L sodium pyruvate. Cells were maintained in media containing 10% fetal bovine serum and treated in serum-free medium.

Western Blot Analysis
Protein was isolated in 1x radioimmunoprecipitation assay buffer with a Complete Mini protease inhibitor tablet from Roche Diagnostics (Indianapolis, IN). DNA was sheared using a 23-gauge needle, then cell lysates were stored at 4°C for 30 minutes followed by centrifugation at 12,000 x g at 4°C for 20 minutes to remove cellular debris. Proteins were quantitated by bicinchoninic acid protein assay (Pierce, Rockford, IL) using bovine serum albumin as a standard and quantitated using a Beckman DU7400 spectrophotometer (Beckman Coulter, Fullerton, CA). Proteins (20 µg) were separated by SDS-PAGE and transferred onto nitrocellulose membranes as previously reported in this laboratory (26, 37). Positive control cell lysates consisted of anisomycin-treated C6 glioma cell extracts (Cell Signaling, Beverly, MA), NSAID, or treatment of HCT-116 cells with the topoisomerase inhibitor etoposide, which is an antitumorigenic drug and potent inducer of apoptosis reported to induce ATF3 (36).

Reverse Transcription and Real-time Reverse Transcription-PCR Using SYBR Green
Real-time reverse transcription-PCR (RT-PCR) was done in triplicate two or more times with individual time-matched vehicle-treated controls for each gene tested or relative to vector-expressing cells for overexpression assays. Real-time RT-PCR primer design, DNase treatment, reverse transcription, and real-time RT-PCR assays were done as previously described by this laboratory (29). The primers used were as follows: ATF3 forward AAGAACGAGAAGCAGCATTTGAT, reverse TTCTGAGCCCGGACAATACAC; Actin forward CCTGGCACCCAGCACAAT, reverse GCCGATCCACACGGAGTACT; plasminogen activator inhibitor 1 (PAI-1) forward TGCTGGTGAATGCCCTCTACT, reverse CGGTCATTCCCAGGTTCTCTA; Maspin forward GCCAGGAGCACGGATCCT, reverse GTTGTGCCTGATGATGTAAATAAAGG; metastasis associated protein-1 (MTA-1) forward GCCCCAAGTTTGCCATGA, reverse GATCCGCGTCAGCTTCGT; ß-catenin forward GCTGGGACCTTGCATAACCTT, reverse ATTTTCACCAGGGCAGGAATG.

RNA Isolation
For tissue culture, cells were rinsed twice with PBS, then RNA was isolated using the Qiagen (Valencia, CA) RNeasy MINI kit according to the instructions of the manufacturer. Cell lysis was done by centrifugation through a Qia-shredder (Qiagen). RNA was quantitated using a Beckman DU7400 spectrophotometer (Beckman Coulter). RNA isolation from mouse tumor xenografts was done as above after tumors were excised and quickly snap frozen in liquid nitrogen, then stored in 10 volumes of RNALater (Ambion, Inc., Austin, TX) according to the instructions of the manufacturer using a Pro200 tissue homogenizer (Pro Instruments, Oxford, CT) and a Qiashredder to remove cellular debris.

Activating Transcription Factor 3 Clones and Transfection Experiments
A construct containing the entire coding region of ATF3 including the TATAA region was generated by RT-PCR using RNA from HCT-116 cells with the following primers: forward CGTGAGTCCTCGGTGCTC, reverse GACAGCTCTCCAATGGCTTC. The resulting 721 bp construct was cloned into pCRII-Topo (Invitrogen, Carlsbad, CA) followed by excision at the HindIII/NotI sites, transferred in the sense and antisense orientations into the expression plasmid pcDNA3.1Zeo+/– (Invitrogen) using T4 DNA ligase (NEB, Beverly, MA), and then confirmed by DNA sequencing. Transient transfections were first carried out to evaluate the expression of full-length ATF3 protein by Western blot analysis as described below. To generate stable pools of cells, the optimal amount of zeocin (600 g/mL) was determined by plating cells in media containing various concentrations of zeocin. Transfection experiments were carried out using 1 µg of the expression plasmid using Lipofectamine/Plus reagent (Invitrogen) according to the instructions of the manufacturer. Stable pools of HCT-116 cells expressing full-length ATF3 sense–, antisense–, or vector (pcDNA3.1Zeo)–expressing cells were isolated following 3 weeks of culture in the presence of zeocin, and expression of ATF3 was routinely detected by Western blot and real-time RT-PCR.

Focus Formation Assays
Stable pools of transfected HCT-116 cells were plated on 15-cm dishes at 3,000 cells/dish for a period of 14 days for focus formation assays, an indication of tumorigenicity. Cells were then washed with PBS, fixed with 100% methanol, and stained with Karyomax Giemsa solution for 2 minutes followed by successive washes with PBS at room temperature to visualize colony growth. Colonies were visualized using a Leica MZ APO confocal microscope equipped with a Sony digital photo camera (DKC-5000) and NCL 150 light source, operated by a PC and Adobe Photoshop. Cells were counted from 10 randomly selected 2 cm2 grids per 15 cm dish. Values are expressed as mean ± SE.

Ectopic Tumorigenicity Assays in Nude Mice
Male athymic nude mice were purchased from National Cancer Institute/Taconic at 5 weeks of age and were maintained in pathogen-free conditions for 1 week to allow for acclimation and during the course of the study were weighed, then randomly divided before use. Mice were housed and treated according to the National Institute of Environmental Health Sciences Animal Care and Use Committee. On day 1, PBS or stable pools of actively growing vector, antisense, and sense HCT-116 cells (3 x 106 cells) were injected s.c. in a final volume of 0.1 mL PBS behind the right forelimb of each mouse (19.3 ± 0.47 g) as previously reported by our laboratory (38). Measurement of the resulting tumor xenografts began when the size was more than 2 mm in diameter (~50 mm3) and proceeded until the animals were sacrificed at the end of the study. Growth curves were determined by measuring the tumors externally in two dimensions. The tumor volume was calculated using the equation V = [(L + W) 0.5] x L x W x 0.5236. The values are reported as mean ± SE of 10 xenografts per group. Mice were sacrificed 28 days after the injections, immediately weighed, and tumors were excised in accordance with National Institute of Environmental Health Sciences Animal Care and Use Committee guidelines. The body weights of the mice did not differ significantly at the end of the study (P < 0.38).

Assessment of Apoptosis by Fluorescence-Activated Cell Sorting Analysis
The DNA content of cells was determined by fluorescence-activated cell sorting analysis. Cells were plated in triplicate two or more times at 2 x 105 cells/well in 12-well plates, incubated overnight, then treated in media containing 5% fetal bovine serum in the presence of vehicle or the indicated compound for 30 hours. After treatment, the cells were rinsed with PBS, harvested, then mixed with Annexin V-FITC in the dark for 15 minutes, centrifuged, then incubated with propidium iodine (Oncogene Research Products, San Diego, CA) according to the instructions of the manufacturer. Seven thousand five hundred cells were examined by flow cytometry using a Becton Dickinson FACSort equipped with CellQuest software by gating on an area versus width dot plot to exclude cell debris and cell aggregates. Apoptosis was measured by the level of subdiploid DNA contained in cells using CellQuest software from the total gated cells. Measurements are relative to fold increase over vehicle-treated cells for nontransfected cells or vehicle-treated/vector-transfected cells for the transfected cells.

Immunohistochemistry
Xenografts were quickly excised and stored in 10% neutral buffered formalin at room temperature overnight, washed several times in ethanol gradient (50–70%), and were paraffin embedded. Expression of ATF3 was confirmed by immunohistochemistry at a primary rabbit antibody concentration of 1:50 and at a secondary rabbit antibody concentration of 1:300 on 4 µm sections. The negative control for these studies was normal rabbit serum at the same dilution as primary antibody (Jackson Immunoresearch Laboratories, Inc., West Grove, PA). Positive control slides were rat pancreas (data not shown). Areas were randomly chosen.

Cell Invasion Assay
Invasion assays were done in 24-well dishes with Millicell cell culture plate inserts (Millipore, Bedford, MA). The upper chamber consisted of an 8 µm pore size and was coated with matrigel basement membrane matrix (BD Biosciences, Bedford, MA) diluted to 1 µg/µL with 100 µL PBS per well and incubated at 37°C for 24 hours. The lower chamber consisted of 750 µL of complete media. Actively growing cells (2.5 x 104 cells) were diluted in 500 µL serum-free medium, added to the upper chamber, and incubated for 48 hours in the absence or presence of vehicle or sulindac sulfide (10 µmol/L) as indicated. Following incubation, media from the upper chamber was removed and cells with matrigel on the upper surface were carefully rinsed and then removed with a cotton swab. The upper chambers were stained with H&E solution (Sigma) following a gentle rinse in PBS solution. Invading cells were counted from several random fields of view from four independent experiments using an Olympus (Melville, NY) AX80 microscope equipped with a DP-70 digital camera (Olympus) and a personal computer equipped with NIH Image 1.61 (200x), and values shown are the mean number of cells from an equal number of fields of view (±SE).

SuperArray Microarray Analysis
GEArray Q series blots (HS-006) were purchased from SuperArray Inc. (Frederick, MD). RNA from vector- and sense-expressing cells plated at 1 x 106 cells/10-cm dish was isolated following a 24-hour incubation in complete media as described above. The procedure for biotinylated cDNA probe synthesis was done using the Ampho-LPR labeling kit (SuperArray). Briefly, 5 µg of total RNA were used as a template for cDNA synthesis and then the cDNA was labeled with biotin-dUTP (Roche) during PCR reaction. Then, the reaction was stopped and denatured at 94°C for 2 minutes and the resulting DNA probe was applied to a prehybridized GEArray membrane. The hybridization was done at 60°C for 12 hours in a hybridization oven. After a two-step washing at 60°C, membranes were blocked and treated with alkaline phosphatase–conjugated streptavidin and finally exposed to CDP-Star alkaline phosphatase chemiluminescent substrate. The membrane was exposed to autoradiographic film. The intensity of the each spot was compared with scion image software using glyceraldehyde-3-phosphate dehydrogenase or cyclophilin as a positive control. Autoradiograms were scanned using a Umax Powerlook III scanner equipped with a transparency adapter and normalized to actin before quantitation using NIH image (Bethesda, MD).

Statistical Analyses
Multiple comparisons were analyzed using ANOVA with Bonferroni's t test for multiple comparisons with P < 0.05 as level of significance versus vector-transfected or vehicle-treated cells unless otherwise indicated. For real-time RT-PCR of array genes, statistical significance was determined according to a two-sided t test with P < 0.05 as level of significance. Analyses on real-time RT-PCR values were following adjustment for actin on Ct values from raw data. For mouse tumor data, multiple comparisons were analyzed at the P < 0.10 level following a log10 transformation to normalize the data for analysis. Values indicated with unique letters or one or more asterisks (*) are statistically significant, whereas values sharing a common letters are not significant. * denotes statistical significance at the P < 0.05 level or P < 0.10 for mouse tumor data; ** denotes statistical significance at the P < 0.01 level; *** denotes statistical significance at the P < 0.001 level. All pairwise comparisons were at P < 0.01.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nonsteroidal Anti-inflammatory Drugs and Other Chemopreventive Compounds Increase the Expression of Activating Transcription Factor 3
HCT-116 cells serve as a model system for studying human colorectal cancer and are frequently used to study changes in gene expression by NSAIDs and other chemopreventive compounds and thus were used for this study. We chose to study the modulation of ATF3 by these compounds because this transcription factor was identified by microarray analysis of sulindac sulfide–treated colorectal cancer cells. ATF3 protein expression was induced by a variety of chemopreventive compounds including the traditional Cox inhibitor sulindac sulfide, the Cox-1–specific inhibitor SC-560, the peroxisome proliferator-activated receptor {gamma} ligand troglitazone, the garlic oil constituent diallyl disulfide, the red wine constituent resveratrol, and the Cox-2–specific inhibitor SC-58125. As illustrated in Fig. 1A, the induction of ATF3 by these compounds occurred in a concentration-dependent manner in HCT-116 colorectal cancer cells. The concentrations used for sulindac sulfide were within the physiologic concentrations observed in humans taking the prodrug sulindac (37), whereas higher concentrations were required for the natural dietary compounds. ATF3 protein expression was increased in a time-dependent manner with significant expression around 4 to 6 hours as illustrated with several of these compounds (Fig. 1B). We next determined if ATF3 was modulated at the mRNA level using real-time RT-PCR. The time course of induction of ATF3 at the mRNA level was determined using sulindac sulfide and SC-560 (Fig. 2A) and these time points were used for subsequent treatments. Sulindac sulfide (10 µmol/L) was a more potent inducer of ATF3 mRNA than SC-560 (10 µmol/L). This was confirmed by Northern blot analysis and correlated with the levels of induction (data not shown and ref. 38). Induction of ATF3 mRNA was time dependent with maximal induction occurring around 4 hours, preceding the induction of ATF3 protein. HCT-116 cells were then treated with vehicle or the six compounds indicated, and mRNA analyzed by real-time RT-PCR. In general, these compounds induced ATF3 at the mRNA level by 2- to 4-fold following a 4-hour treatment, whereas troglitazone induced ATF3 by 8.7-fold at this time point (Fig. 2B). However, resveratrol, SC-58125, and diallyl disulfide induced ATF3 to a greater extent at higher concentrations (Fig. 2C). We next determined if these compounds induced ATF3 protein expression in different cancer cells such as breast, ostosarcoma, prostate, and glioblastoma cancer cells using MCF-7, PC-3, and U87MG cell lines, respectively. The increase in ATF3 expression was observed in these cell lines following treatment with these chemopreventive agents, therefore ATF3 is responsive in a wide variety of cell types (Fig. 3). SC-58125 did not induce ATF3 in the highly malignant U87MG cell line as has been reported in SW-480 cells (38).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 1. ATF3 protein expression is induced by NSAIDs and chemopreventive compounds in a concentration-dependent manner in HCT-116 cells. A, HCT-116 cells were incubated in serum-free medium with vehicle (lane 1); 5, 10, 20, and 30 µmol/L sulindac sulfide; 0.1, 1, 5, and 10 µmol/L troglitazone (TGZ); 10, 25, 50, and 100 µmol/L SC-560; 10, 20, 30, and 50 µmol/L diallyl disulfide (DADS); or 10, 20, 30, and 50 µmol/L resveratrol for 6 h; or 10, 25, 50, and 100 µmol/L SC-58125 for 24 h. The positive control was 20 µmol/L etoposide (+). B, ATF3 protein expression is induced by NSAIDs and chemopreventive compounds in a time-dependent manner in HCT-116 cells. HCT-116 cells were incubated with vehicle, 25 µmol/L SC-560, or 20 µmol/L sulindac sulfide and vehicle, 5 µmol/L troglitazone, or 20 µmol/L diallyl disulfide in serum-free medium for the times indicated followed by protein isolation and Western blot analysis for ATF3 and actin. The positive control (+) consisted of anisomycin-treated C6 glioma cell extracts.

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. NSAIDs induce ATF3 mRNA in HCT-116 cells. HCT-116 cells were treated with vehicle or the indicated compounds in serum-free medium followed by RNA isolation and real-time RT-PCR for ATF3 and actin. A, HCT-116 cells were treated with vehicle, sulindac sulfide (10 µmol/L), or SC-560 (10 µmol/L) for the times indicated [points, mean (relative to time-matched vehicle-treated cells); bars, SD]. B, HCT-116 cells were treated with vehicle, 25 µmol/L diallyl disulfide, 25 µmol/L resveratrol, 20 µmol/L sulindac sulfide, 25 µmol/L SC-560, 5 µmol/L troglitazone, or 50 µmol/L SC-58125 for 4 h. C, HCT-116 cells were treated with vehicle, resveratrol, SC-58125, or diallyl disulfide for 4 h at the concentrations indicated (points, mean fold induction over vehicle-treated cells; bars, SE). Values are expressed as fold induction relative to vehicle-treated cells adjusted for actin.

 


View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. The induction of ATF3 is not cell line dependent. MCF-7 cells were incubated with vehicle, 5, 10, 20, or 30 µmol/L sulindac sulfide (A) or vehicle, 0.1, 1, 5, or 10 µmol/L troglitazone (B). PC-3 cells were treated with vehicle, 10, 20, 30, or 50 µmol/L of diallyl disulfide (C) or vehicle, 10, 20, 30, or 50 µmol/L of resveratrol (D), or 20 µmol/L sulindac sulfide as a positive control (+). U87MG cells were treated with vehicle, 25, 50, or 100 µmol/L SC-560 (E) or SC-58125 (F). Cells were incubated for 6 h in serum-free medium followed by protein isolation and Western blot analysis of ATF3 and actin. U87MG cells were treated for 24 h due to the low expression of ATF3 in these cells.

 
Evaluation of Activating Transcription Factor 3–Overexpressing Cells
To study the biological activity of ATF3, ATF3 was cloned into the expression vector plasmid pcDNA3.1Zeo in the sense and antisense orientations. Stable pools of cells containing vector or full-length ATF3 in the sense and antisense orientations were generated. Protein expression of ATF3 was determined in these stable pools of cells. Relative to the vector cells, cells overexpressing full-length ATF3 in the sense orientation showed a dramatic increase in ATF3 protein and mRNA expression whereas some suppression was seen in the antisense cells relative to vector cells (Fig. 4A–B).



View larger version (82K):
[in this window]
[in a new window]
 
Figure 4. Overexpression of ATF3 in colorectal cancer cells has antitumorigenic activity. A, Western blot analysis demonstrating expression of ATF3 in stable pools of vector-, antisense-, and sense-transfected HCT-116 cells. Western blot analysis of proteins from vector-transfected HCT-116 cells (V), ATF3 antisense–expressing cells (AS), and ATF3 sense–overexpressing cells (S). Cells were plated in complete media and allowed to recover for 24 h. B, real-time RT-PCR analysis of ATF3 mRNA in vector, antisense, and sense cells. Values shown in parentheses and above the bars are fold expression relative to vector transfected cells and adjusted for actin. C, focus formation assay, an indication of tumorigenicity, was determined by plating stably transfected HCT-116 cells at 3,000 cells/dish on 15-cm dishes for a period of 14 d without agitation as described in Materials and Methods. Columns, mean fold change, relative to vector transfected cells; bars, ±SE. D, overexpression of ATF3 inhibits tumor size in athymic nude mice using a mouse xenograft model of tumorigenicity. Values indicated with an asterisk (*) are statistically significant. *, P < 0.10; **, P < 0.01; ***, P < 0.001. E–F, immunohistochemistry of ATF3 protein expression in mouse tumor xenografts. Expression of ATF3 (brown areas) was detected following immunohistochemistry of ATF3 from vector (E), antisense (F), and sense tumors (G). H, negative control (rabbit serum); 20x objective.

 
Antitumorigenic Activity of Activating Transcription Factor 3
To determine if ATF3 affects tumorigenicity, two different assays were used. Focus formation, an indication of tumorigenicity, and mouse xenografts were used with the vector, antisense, and sense cells. ATF3 expression in the sense cells significantly suppressed focus formation whereas the suppression of ATF3 in the antisense cells resulted in a significant increase in colony formation, indicating antitumorigenic activity for ATF3 according to this assay (Fig. 4C; Table 1). These results suggest that ATF3 expression will inhibit tumor formation. To support this conclusion, the mouse tumor xenograft model was used. Athymic nude mice were injected s.c. with HCT-116 cells (sham injected, vector, sense, and antisense) into nude mice using a mouse xenograft model. Mice from the three treatment groups had measurable tumors at 14 days after injection (Fig. 4D). Twenty-eight days after the injections, mice were weighed and then sacrificed. Tumors from ATF3 sense–expressing cells were the smallest (209.0 ± 39.2 mm3), which was 46% of the size of tumors from vector-expressing mice (452.9 ± 96.3 mm3). Tumors from ATF3 antisense cells (585.9 ± 192.5 mm3) were the largest at 129% of the size of tumors from vector-expressing cells (Table 1) and were histologically less distinct than those from the vector or ATF3 sense tumors, making measurements more difficult and variable. Thus, a 54% reduction in tumor size in the sense tumors and a 28% increase over vector in the antisense tumors were observed. To confirm the expression of ATF3 in the sense-expressing tumors, mRNA levels were determined by real-time RT-PCR from mRNA and immunohistochemistry. ATF3 was significantly induced (26.3 ± 1.4-fold, P < 0.001) relative to the vector-containing tumors (1.0 ± 0.03), indicating overexpression occurred in these tumors, and it was maintained throughout the study period; whereas a relatively small insignificant increase (2.0 ± 0.1-fold, P = 0.8) in ATF3 mRNA expression was detected in the antisense tumors at the time point tested. In addition, representative tumors were formalin fixed and examined by immunohistochemistry for the expression of ATF3. A significant number of cells were positive for ATF3 protein expression in the sense tumors (Fig. 4G) relative to cells in the vector (Fig. 4E) and antisense (Fig. 4F) tumors, which is in agreement with the mRNA data. This is evident not only by the overall degree of staining but also by the number of highly stained cells, particularly along borders. No expression was detected using rabbit serum as a negative control (Fig. 4H).


View this table:
[in this window]
[in a new window]
 
Table 1. Overexpression of ATF3 inhibits tumor growth

 
Activating Transcription Factor 3 Overexpression Is Not Responsible for Nonsteroidal Anti-inflammatory Drug–Induced Apoptosis
NSAIDs such as sulindac sulfide induce apoptosis and alterations in apoptosis seem to explain, at least in part, the antitumorigenic activity of these and other compounds, and we wanted to determine if ATF3 is involved in this process. Therefore, we first confirmed that sulindac sulfide induces apoptosis in these cells. Sulindac sulfide induces apoptosis in HCT-116 cells after a 30-hour treatment in a concentration-dependent manner (Fig. 5A). To determine if ATF3 was involved in the apoptotic response, we measured the apoptotic response in ATF3 vector–, sense–, and antisense–transfected cells. Cells expressing ATF3 did not have a significant effect on the induction of apoptosis in the absence of treatment according to ANOVA (Fig. 5B; P = 0.13). Therefore, overexpression of ATF3 in the sense orientation did not induce apoptosis; thus, other mechanisms are likely involved.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. Sulindac sulfide, but not ATF3 overexpression, induces apoptosis whereas sulindac sulfide and ATF3 modulate tumor cell invasion. Cells were treated with vehicle or various concentrations of sulindac sulfide as indicated for 30 h (A) or stably transfected HCT-116 cells were untreated in media containing 5% fetal bovine serum (B), followed by isolation and detection of apoptosis by fluorescence-activated cell sorting analysis as measured by propidium iodine/Annexin V staining. C–D, matrigel invasion assay, an indication of invasion potential, was determined using HCT-116 cells transiently transfected with vector, sense, or antisense ATF3 and recovered for 48 h alone (C) or in the presence of vehicle or sulindac sulfide (10 µmol/L; D). Invading cells were counted from several random fields of view from four independent experiments and are illustrated as relative invasion potential (±SE). Values shown in A are relative to vehicle-treated cells. Values shown in B are relative to vector-transfected cells. C–D, statistical significance is according to ANOVA with Bonferonni's t test for multiple comparisons (C) relative to vector transfected cells or all pairwise comparisons (D; P < 0.01). Values sharing a common letter are not significantly different. *, P < 0.05; **, P < 0.01.

 
Overexpression of Activating Transcription Factor 3 Modulates Genes Related to Invasion
Microarray analysis of total RNA from ATF3 sense– versus vector–expressing HCT-116 cells was done in an attempt to reveal possible candidate genes that may explain the antitumorigenic effects of ATF3. The cancer pathway microarray chip was chosen because it consists of 96 genes that relate to cancer via six common biological pathways. Twelve genes were initially detected as induced or repressed by ATF3 overexpression. After further study, 4 of the 12 genes initially detected were consistently regulated by ATF3 overexpression according to real-time RT-PCR and are therefore indicated in Table 2. ATF3 was measured as a control and was induced 5.8-fold. Two genes were induced, Maspin and PAI-1, whereas two genes were repressed, MTA-1 and ß-catenin. Each of these genes relates to invasion and metastasis. Subsequently, we determined if these genes were modulated by sulindac sulfide to determine if ATF3 overexpression may, in part, explain the anti-invasive activity of this and perhaps other NSAIDs. Several of these genes were modulated by sulindac sulfide independent of artificial ATF3 overexpression. However, maspin, which was induced by ATF3 overexpression, was consistently repressed by sulindac sulfide, indicating the global patterns of gene expression and that the involvement of these drugs are complex.


View this table:
[in this window]
[in a new window]
 
Table 2. Overexpression of ATF3 modulates the expression of genes related to invasion

 
Activating Transcription Factor 3 Modulates Tumor Cell Invasion
NSAIDs such as sulindac sulfide are known to inhibit invasion. Because microarray analysis followed by real-time RT-PCR confirmed that ATF3 and sulindac sulfide alter the expression of genes related to invasion, and ATF3 overexpression seems to have an antitumorigenic role independent of apoptosis, the invasion of these cells alone and following treatment with vehicle or sulindac sulfide was determined using matrigel-coated membranes. Transiently transfected HCT-116 cells were plated onto matrigel basement membrane–coated millicell inserts and incubated for 48 hours. In agreement with the anti-invasive nature of ATF3 at the gene expression level, ATF3 sense cells had a decrease in invasion on matrigel-coated plates. Conversely, ATF3 antisense cells had an increase in invasion (Fig. 5C), a further indication of the antitumorigenic role for ATF3. Sulindac sulfide inhibited invasion in each of the ATF3 clones as illustrated in Fig. 5D, indicating that ATF3 modulates tumor cell invasion and seems to be, at least in part, one way NSAIDs elicit their antitumorigenic response as sulindac sulfide plus ATF3 overexpression resulted in the greatest inhibition and sulindac sulfide restored the degree of invasion in the antisense cells to that of the untreated vector-containing cells.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NSAIDs and certain dietary compounds reduce the risk of colorectal cancer in humans and in animal models as illustrated in a recent review (39). Increasing evidence suggests that NSAIDs and other chemopreventive compounds work through a variety of mechanisms, in addition to their Cox-inhibitory activity. One mechanism that may, in part, explain the chemopreventive effects of NSAIDs is through gene modulation that could lead to alterations in invasion, apoptosis, cell proliferation, and angiogenesis. Previously, our laboratory used subtractive hybridization to study changes in gene expression by NSAIDs and identified the gene NAG-1, a novel member of the transforming growth factor ß superfamily (40). The overexpression of NAG-1 induces apoptosis in cultured cells and suppresses the growth of xenograft in nude mice (41), but it is likely that several other genes are also involved in the proapoptotic, antitumorigenic, and anti-invasive effects of Cox inhibitors and other chemopreventive compounds. For example, microarray analysis revealed 65 genes either induced or repressed by physiologic concentrations of sulindac sulfide (29). One gene, ATF3, was considered for further study because it is a transcription factor involved in cell proliferation, apoptosis, and invasion, and its expression is down-regulated in colorectal tumors (29). ATF3 expression is modulated by a wide variety of compounds including NSAIDs (29, 38), genotoxic agents (ionizing radiation, UV radiation, and methyl methanesulfonate; ref. 42), peroxisome proliferator-activated receptor {gamma} ligands (43), dietary compounds with cytotoxic activity and documented anticancer properties (34, 44), anticancer drugs (35, 36), and growth factors (45, 46). The mechanisms of regulation for ATF3 are as diverse as the compounds that regulate ATF3 (for a review, see ref. 47). Induction of ATF3 occurs at the promoter level at least for several compounds. For example, gene regulatory pathways that modulate ATF3 include p53, p38, mitogen-activated protein kinase kinase kinase 1, c-jun-NH2-kinase, and its own promoter. Furthermore, ATF3 is a transcription factor known to regulate several genes relating to cell growth, apoptosis (30, 48), and invasion (32, 49, 50).

In this report, we examine the biological activity of ATF3 in an attempt to determine if this gene could be involved in the chemopreventive activity of NSAIDs and other agents. A wide variety of compounds with chemopreventive and/or chemotherapeutic activity increase the expression of ATF3 in a time- and concentration-dependent manner in HCT-116 colorectal cancer cells. ATF3 is induced at the mRNA and protein levels by NSAIDs, troglitazone, diallyl disulfide, and resveratrol. We report for the first time that overexpression of ATF3 protein exerts antitumorigenic activity, as determined with mouse xenograft models and other assays, and anti-invasive activity in vitro in colorectal cancer cells. ATF3 sense cells yielded smaller tumors when injected into nude mice whereas tumors from the antisense cells were modestly increased in size and histologically less distinct in the mouse xenograft model. Immunohistochemistry of ATF3 from these tumors revealed an increase in ATF3 expression in the sense tumors, particularly at edges and borders. However, no suppression of ATF3 was seen in the antisense tumors, which is consistent with the mRNA data and the inability of ATF3 suppression to significantly induce tumorigenicity in vivo. Similar antitumorigenic activity resulted with ATF3 overexpression when using an in vitro assay for tumorigenicity. However, significant suppression of ATF3 was seen along with an increase in tumorigenicity in the antisense cells. Therefore, it is unclear if inhibition of ATF3 has antitumorigenic activity in vivo. Whereas suppression of ATF3 modestly inhibited the induction of apoptosis, the antitumorigenic activity of ATF3 overexpression does not seem to be via the induction of apoptosis or the inhibition of cell proliferation (data not shown) in this study; thus, other mechanisms are likely involved. In an attempt to explain the biological effects of ATF3, we did microarray analysis, which revealed that ATF3 expression alters the expression of several genes related to invasion. For example, maspin, PAI-1, ß-catenin, and MTA-1 were altered at the mRNA level as determined by real-time RT-PCR. This may occur directly by ATF3 binding to the promoter of these genes or by regulation of inhibitors of these genes. Most of these genes are also regulated by sulindac sulfide, indicating that ATF3 may be involved in the induction of these genes following treatment with Cox inhibitors, thereby linking the gene regulatory role of these compounds to ATF3. Subsequently, we evaluated the invasion potential of these cells. ATF3 expression inhibited invasion whereas invasion was increased in the antisense cells. Sulindac sulfide treatment inhibited invasion in each of these cells and ATF3 expression inhibited invasion to a similar extent as sulindac sulfide. Furthermore, the expression of ATF3 increased sulindac sulfide–induced inhibition of invasion. Conversely, ATF3 antisense cells had increased invasion and attenuated the inhibition of invasion by sulindac sulfide. These results suggest that the anti-invasive role of NSAIDs may be dependent, in part, on an increase in ATF3 expression.

The modulation of invasion by ATF3 is likely linked to the global pattern of gene expression modulated by ATF3 and some NSAIDs such as sulindac sulfide. ATF3 is a transcription factor known to both induce and repress gene expression. We hypothesize that gene modulation downstream of ATF3 may be responsible for its antitumorigenic effects. ATF3 modulates the expression of genes linked to cancer including gadd153/Chop10, which is associated with cell growth (30), and MMP-2, which is associated with invasion (3133), and ATF3 is regulated by and interacts with the antitumor gene p53 (31). Genes found to be modulated by ATF3 include maspin, a serine protease inhibitor that is down-regulated in colorectal (51) and mammary tumors and related to invasion, angiogenesis, and metastasis (52), and thus may relate to changes in and invasion by ATF3. In addition, PAI-1 is altered and linked to metastasis and invasion, reducing the ability of cells to invade (53). MTA-1 and ß-catenin were repressed by ATF3 overexpression. Induction of MTA-1 correlates with increased invasion, illustrated by the fact that overexpression of MTA-1 in vitro increases cancer cell migration and invasion whereas MTA-1 is up-regulated in aggressive epithelial neoplasms in vivo (54). Whereas ß-catenin is often mutated in cancer cells, suppression of ß-catenin is reported in colorectal tissue following sulindac treatment in humans with familial adenomatous polyposis (55). Indomethacin decreases ß-catenin in colorectal cancer cells undergoing G1 cycle arrest and apoptosis (56). NSAIDs such as sulindac (15) and aspirin (14) inhibit invasion, at least in part, via suppression of the proinvasive gene MMP-2. Furthermore, ATF3 suppresses transcription of MMP-2 by binding to and inhibiting the promoter of MMP-2 (3133). Therefore, it would seem that ATF3 has anti-invasive activity by altering the expression of genes related to invasion, and ATF3 seems to play an important role in the inhibition of invasion by NSAIDs.

In conclusion, NSAIDs and certain dietary compounds have chemopreventive activity as well as antitumorigenic and anti-invasive activities in humans in vitro and in animal models in vivo. Several of the compounds illustrated here and elsewhere modulate the expression of ATF3, which is indirectly linked with the suppression of invasion via MMP-2, as observed in other studies, and directly for the first time following overexpression using a variety of assays and indirectly via NSAIDs as illustrated in this study. ATF3 modulates the expression of several other downstream genes related to invasion, which are likely linked to this activity. The increased expression of ATF3 is a new mechanism to explain the inhibition of invasion reported by treatment with NSAIDs. The chemopreventive activity of NSAIDs has been linked to induction of apoptosis, inhibition of cell growth, alterations in angiogenesis, and inhibition of invasion. Whereas Cox inhibition by NSAIDs also plays an important role in the inhibition of tumorigenicity, the global pattern of gene expression and changes in the expression these genes seem to be involved with this activity. NSAIDs alter the expression of genes that seem to be linked with many of these biological responses in addition to those seen here. For example, some NSAIDs and other compounds induce NAG-1 expression, resulting in the induction of apoptosis and inhibition of tumorigenicity. Cox inhibitors and certain anticancer drugs repress laminin {gamma}1 expression (57) also resulting in the inhibition of invasion. Thus, NSAIDs alter a number of genes associated with apoptosis, invasion, and angiogenesis. The interaction and balance between the expressed genes seem to determine the chemopreventive activity of these compounds. Other genes related to invasion are likely altered by NSAIDs and other chemopreventive agents and, therefore, additional experiments are required to elucidate the precise mechanisms explaining the chemopreventive activity of NSAIDs and other chemopreventive agents.


    Acknowledgments
 
We thank Julie Foley, Norris Flagler, and Tiwanda Marsh for the immunohistochemistry work and Dr. Robert Langenbach for his critical comments and suggestions.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 12/16/04; revised 1/24/05; accepted 3/ 2/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Greenlee RT, Murray T, Bolden S, Wingo PA. Cancer statistics, 2000. CA Cancer J Clin 2000;50:7–33.[Abstract]
  2. Thun MJ, Henley SJ, Patrono C. Nonsteroidal anti-inflammatory drugs as anticancer agents: mechanistic, pharmacologic, and clinical issues. J Natl Cancer Inst 2002;94:252–66.[Abstract/Free Full Text]
  3. Beazer-Barclay Y, Levy DB, Moser AR, et al. Sulindac suppresses tumorigenesis in the Min mouse. Carcinogenesis 1996;17:1757–60.[Abstract/Free Full Text]
  4. Chiu CH, McEntee MF, Whelan J. Sulindac causes rapid regression of preexisting tumors in Min/+ mice independent of prostaglandin biosynthesis. Cancer Res 1997;57:4267–73.[Abstract/Free Full Text]
  5. Noguchi M, Taniya T, Koyasaki N, Kumaki T, Miyazaki I, Mizukami Y. Effects of the prostaglandin synthetase inhibitor indomethacin on tumorigenesis, tumor proliferation, cell kinetics, and receptor contents of 7,12-dimethylbenz(a)anthracene-induced mammary carcinoma in Sprague-Dawley rats fed a high- or low-fat diet. Cancer Res 1991;51:2683–9.[Abstract/Free Full Text]
  6. McCormick DL, Madigan MJ, Moon RC. Modulation of rat mammary carcinogenesis by indomethacin. Cancer Res 1985;45:1803–8.[Abstract/Free Full Text]
  7. Williams CS, Sheng H, Brockman JA, et al. A cyclooxygenase-2 inhibitor (SC-58125) blocks growth of established human colon cancer xenografts. Neoplasia (New York, N. Y.) 2001;3:428–36.
  8. Grosch S, Tegeder I, Niederberger E, Brautigam L, Geisslinger G. COX-2 independent induction of cell cycle arrest and apoptosis in colon cancer cells by the selective COX-2 inhibitor celecoxib. FASEB J 2001;15:2742–4.[Free Full Text]
  9. Giardiello FM, Offerhaus GJ, DuBois RN. The role of nonsteroidal anti-inflammatory drugs in colorectal cancer prevention. Eur J Cancer 1995;31A:1071–6.
  10. Baron JA, Cole BF, Sandler RS, et al. A randomized trial of aspirin to prevent colorectal adenomas. N Engl J Med 2003;348:891–9.[Abstract/Free Full Text]
  11. Sandler RS, Halabi S, Baron JA, et al. A randomized trial of aspirin to prevent colorectal adenomas in patients with previous colorectal cancer. N Engl J Med 2003;348:883–90.[Abstract/Free Full Text]
  12. Winde G, Gumbinger HG, Osswald H, Kemper F, Bunte H. The NSAID sulindac reverses rectal adenomas in colectomized patients with familial adenomatous polyposis: clinical results of a dose-finding study on rectal sulindac administration. Int J Colorectal Dis 1993;8:13–7.[CrossRef][Medline]
  13. Ito H, Duxbury M, Benoit E, et al. Prostaglandin E2 Enhances Pancreatic Cancer Invasiveness through an Ets-1-Dependent Induction of Matrix Metalloproteinase-2. Cancer Res 2004;64:7439–46.[Abstract/Free Full Text]
  14. Jiang MC, Liao CF, Lee PH. Aspirin inhibits matrix metalloproteinase-2 activity, increases E-cadherin production, and inhibits in vitro invasion of tumor cells. Biochem Biophys Res Commun 2001;282:671–7.[CrossRef][Medline]
  15. Fu SL, Wu YL, Zhang YP, Qiao MM, Chen Y. Anti-cancer effects of COX-2 inhibitors and their correlation with angiogenesis and invasion in gastric cancer. World J Gastroenterol 2004;10:1971–4.[Medline]
  16. Wei D, Wang L, He Y, Xiong HQ, Abbruzzese JL, Xie K. Celecoxib inhibits vascular endothelial growth factor expression in and reduces angiogenesis and metastasis of human pancreatic cancer via suppression of Sp1 transcription factor activity. Cancer Res 2004;64:2030–8.[Abstract/Free Full Text]
  17. Rodrigues S, Nguyen QD, Faivre S, et al. Activation of cellular invasion by trefoil peptides and src is mediated by cyclooxygenase- and thromboxane A2 receptor-dependent signaling pathways. FASEB J 2001;15:1517–28.[Abstract/Free Full Text]
  18. Kundu N, Fulton AM. Selective cyclooxygenase (COX)-1 or COX-2 inhibitors control metastatic disease in a murine model of breast cancer. Cancer Res 2002;62:2343–6.[Abstract/Free Full Text]
  19. Carolin KA, Pass HA. Prevention of breast cancer. Crit Rev Oncol Hematol 2000;33:221–38.[Medline]
  20. Sundaram SG, Milner JA. Diallyl disulfide suppresses the growth of human colon tumor cell xenografts in athymic nude mice. J Nutr 1996;126:1355–61.
  21. Liu HS, Pan CE, Yang W, Liu XM. Antitumor and immunomodulatory activity of resveratrol on experimentally implanted tumor of H22 in Balb/c mice. World J Gastroenterol 2003;9:1474–6.[Medline]
  22. Baek SJ, Wilson LC, Eling TE. Resveratrol enhances the expression of non-steroidal anti-inflammatory drug-activated gene (NAG-1) by increasing the expression of p53. Carcinogenesis 2002;23:425–34.[Abstract/Free Full Text]
  23. Nakagawa H, Tsuta K, Kiuchi K, et al. Growth inhibitory effects of diallyl disulfide on human breast cancer cell lines. Carcinogenesis 2001;22:891–7.[Abstract/Free Full Text]
  24. You WC, Blot WJ, Chang YS, et al. Allium vegetables and reduced risk of stomach cancer. J Natl Cancer Inst 1989;81:162–4.[Abstract/Free Full Text]
  25. Witte JS, Longnecker MP, Bird CL, Lee ER, Frankl HD, Haile RW. Relation of vegetable, fruit, and grain consumption to colorectal adenomatous polyps. Am J Epidemiol 1996;144:1015–25.[Abstract/Free Full Text]
  26. Bottone FG Jr, Baek SJ, Nixon JB, Eling TE. Diallyl disulfide (DADS) induces the antitumorigenic NSAID-activated gene (NAG-1) by a p53-dependent mechanism in human colorectal HCT 116 cells. J Nutr 2002;132:773–8.[Abstract/Free Full Text]
  27. Kubota T, Koshizuka K, Williamson EA, et al. Ligand for peroxisome proliferator-activated receptor {gamma} (troglitazone) has potent antitumor effect against human prostate cancer both in vitro and in vivo. Cancer Res 1998;58:3344–52.[Abstract/Free Full Text]
  28. Baek SJ, Kim JS, Nixon JB, DiAugustine RP, Eling TE. Expression of NAG-1, a transforming growth factor-ß superfamily member, by troglitazone requires the early growth response gene EGR-1. J Biol Chem 2004;279:6883–92.[Abstract/Free Full Text]
  29. Bottone FG Jr, Martinez JM, Collins JB, Afshari CA, Eling TE. Gene modulation by the cyclooxygenase inhibitor, sulindac sulfide, in human colorectal carcinoma cells: POSSIBLE LINK TO APOPTOSIS. J Biol Chem 2003;278:25790–801.[Abstract/Free Full Text]
  30. Fawcett TW, Martindale JL, Guyton KZ, Hai T, Holbrook NJ. Complexes containing activating transcription factor (ATF)/cAMP-responsive-element-binding protein (CREB) interact with the CCAAT/enhancer-binding protein (C/EBP)-ATF composite site to regulate Gadd153 expression during the stress response. Biochem J 1999;339:135–41.
  31. Yan C, Wang H, Boyd DD. ATF3 represses 72-kDa type IV collagenase (MMP-2) expression by antagonizing p53-dependent trans-activation of the collagenase promoter. J Biol Chem 2002;277:10804–12.[Abstract/Free Full Text]
  32. Stearns ME, Kim G, Garcia F, Wang M. Interleukin-10 induced activating transcription factor 3 transcriptional suppression of matrix metalloproteinase-2 gene expression in human prostate CPTX-1532 cells. Mol Cancer Res 2004;2:403–16.[Abstract/Free Full Text]
  33. Chen HH, Wang DL. Nitric oxide inhibits matrix metalloproteinase-2 expression via the induction of activating transcription factor 3 in endothelial cells. Mol Pharmacol 2004;65:1130–40.[Abstract/Free Full Text]
  34. Carter TH, Liu K, Ralph W Jr, et al. Diindolylmethane alters gene expression in human keratinocytes in vitro. J Nutr 2002;132:3314–24.[Abstract/Free Full Text]
  35. Shtil AA, Mandlekar S, Yu R, et al. Differential regulation of mitogen-activated protein kinases by microtubule-binding agents in human breast cancer cells. Oncogene 1999;18:377–84.[CrossRef][Medline]
  36. Mashima T, Udagawa S, Tsuruo T. Involvement of transcriptional repressor ATF3 in acceleration of caspase protease activation during DNA damaging agent-induced apoptosis. J Cell Physiol 2001;188:352–8.[CrossRef][Medline]
  37. American Society of Health-System Pharmacists. AHFS drug information. Bethesda, MD: Published by authority of the Board of Directors of the American Society of Hospital Pharmacists; 2003:v.
  38. Bottone FG Jr, Martinez JM, Alston-Mills B, Eling TE. Gene modulation by Cox-1 and Cox-2 specific inhibitors in human colorectal carcinoma cancer cells. Carcinogenesis 2004;25:349–57.[Abstract/Free Full Text]
  39. Corpet DE, Pierre F. Point: From animal models to prevention of colon cancer. Systematic review of chemoprevention in min mice and choice of the model system. Cancer Epidemiol Biomarkers Prev 2003;12:391–400.[Abstract/Free Full Text]
  40. Baek SJ, Horowitz JM, Eling TE. Molecular cloning and characterization of human nonsteroidal anti-inflammatory drug-activated gene promoter. Basal transcription is mediated by Sp1 and Sp3. J Biol Chem 2001;276:33384–92.[Abstract/Free Full Text]
  41. Baek SJ, Kim KS, Nixon JB, Wilson LC, Eling TE. Cyclooxygenase inhibitors regulate the expression of a TGF-ß superfamily member that has proapoptotic and antitumorigenic activities. Mol Pharmacol 2001;59:901–8.[Abstract/Free Full Text]
  42. Fan F, Jin S, Amundson SA, et al. ATF3 induction following DNA damage is regulated by distinct signaling pathways and overexpression of ATF3 protein suppresses cells growth. Oncogene 2002;21:7488–96.[CrossRef][Medline]
  43. Nawa T, Nawa MT, Cai Y, et al. Repression of TNF-{alpha}-induced E-selectin expression by PPAR activators: involvement of transcriptional repressor LRF-1/ATF3. Biochem Biophys Res Commun 2000;275:406–11.[CrossRef][Medline]
  44. Baek SJ, Kim JS, Jackson FR, Eling TE, McEntee MF, Lee SH. Epicatechin gallate-induced expression of NAG-1 is associated with growth inhibition and apoptosis in colon cancer cells. Carcinogenesis 2004;25:2425–32.[Abstract/Free Full Text]
  45. Kang Y, Chen CR, Massague J. A self-enabling TGFß response coupled to stress signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial cells. Mol Cell 2003;11:915–26.[CrossRef][Medline]
  46. Inoue K, Zama T, Kamimoto T, et al. TNF{alpha}-induced ATF3 expression is bidirectionally regulated by the JNK and ERK pathways in vascular endothelial cells. Genes Cells 2004;9:59–70.[Abstract/Free Full Text]
  47. Hai T, Wolfgang CD, Marsee DK, Allen AE, Sivaprasad U. ATF3 and stress responses. Gene Expr 1999;7:321–35.[Medline]
  48. Nakagomi S, Suzuki Y, Namikawa K, Kiryu-Seo S, Kiyama H. Expression of the activating transcription factor 3 prevents c-Jun N-terminal kinase-induced neuronal death by promoting heat shock protein 27 expression and Akt activation. J Neurosci 2003;23:5187–96.[Abstract/Free Full Text]
  49. Ishiguro T, Nagawa H. ATF3 gene regulates cell form and migration potential of HT29 colon cancer cells. Oncol Res 2000;12:343–6.[Medline]
  50. Ishiguro T, Nagawa H, Naito M, Tsuruo T. Inhibitory effect of ATF3 antisense oligonucleotide on ectopic growth of HT29 human colon cancer cells. Jpn J Cancer Res 2000;91:833–6.[CrossRef][Medline]
  51. Song SY, Lee SK, Kim DH, et al. Expression of maspin in colon cancers: its relationship with p53 expression and microvessel density. Dig Dis Sci 2002;47:1831–5.[CrossRef][Medline]
  52. Maass N, Hojo T, Zhang M, Sager R, Jonat W, Nagasaki K. Maspin—a novel protease inhibitor with tumor-suppressing activity in breast cancer. Acta Oncol 2000;39:931–4.[CrossRef][Medline]
  53. Swiercz R, Keck RW, Skrzypczak-Jankun E, Selman SH, Jankun J. Recombinant PAI-1inhibits angiogenesis and reduces size of LNCaP prostate cancer xenografts in SCID mice. Oncol Rep 2001;8:463–70.[Medline]
  54. Mahoney MG, Simpson A, Jost M, et al. Metastasis-associated protein (MTA)1 enhances migration, invasion, and anchorage-independent survival of immortalized human keratinocytes. Oncogene 2002;21:2161–70.[CrossRef][Medline]
  55. Boon EM, Keller JJ, Wormhoudt TA, et al. Sulindac targets nuclear ß-catenin accumulation and Wnt signalling in adenomas of patients with familial adenomatous polyposis and in human colorectal cancer cell lines. Br J Cancer 2004;90:224–9.[CrossRef][Medline]
  56. Hawcroft G, D'Amico M, Albanese C, Markham AF, Pestell RG, Hull MA. Indomethacin induces differential expression of ß-catenin, {gamma}-catenin and T-cell factor target genes in human colorectal cancer cells. Carcinogenesis 2002;23:107–14.[Abstract/Free Full Text]
  57. Ishibashi M, Bottone FG Jr, Taniura S, Kamitani H, Watanabe T, Eling TE. The cyclooxygenase inhibitor indomethacin modulates gene expression and represses the extracellular matrix protein laminin {gamma}1 in human glioblastoma cells. Exp Cell Res 2005;302:244–52.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
C. Moser, S. A. Lang, S. Kainz, A. Gaumann, S. Fichtner-Feigl, G. E. Koehl, H. J. Schlitt, E. K. Geissler, and O. Stoeltzing
Blocking heat shock protein-90 inhibits the invasive properties and hepatic growth of human colon cancer cells and improves the efficacy of oxaliplatin in p53-deficient colon cancer tumors in vivo
Mol. Cancer Ther., November 1, 2007; 6(11): 2868 - 2878.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. D. Cho, K. Yoon, S. Chintharlapalli, M. Abdelrahim, P. Lei, S. Hamilton, S. Khan, S. K. Ramaiah, and S. Safe
Nur77 Agonists Induce Proapoptotic Genes and Responses in Colon Cancer Cells through Nuclear Receptor-Dependent and Nuclear Receptor-Independent Pathways
Cancer Res., January 15, 2007; 67(2): 674 - 683.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Bandyopadhyay, Y. Wang, R. Zhan, S. K. Pai, M. Watabe, M. Iiizumi, E. Furuta, S. Mohinta, W. Liu, S. Hirota, et al.
The Tumor Metastasis Suppressor Gene Drg-1 Down-regulates the Expression of Activating Transcription Factor 3 in Prostate Cancer
Cancer Res., December 15, 2006; 66(24): 11983 - 11990.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
M. A. Garcia, J. Gil, I. Ventoso, S. Guerra, E. Domingo, C. Rivas, and M. Esteban
Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action
Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 1032 - 1060.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Cebrian, P. D. Pharoah, S. Ahmed, S. Ropero, M. F. Fraga, P. L. Smith, D. Conroy, R. Luben, B. Perkins, D. F. Easton, et al.
Genetic variants in epigenetic genes and breast cancer risk
Carcinogenesis, August 1, 2006; 27(8): 1661 - 1669.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Guerra, L. A. Lopez-Fernandez, M. A. Garcia, A. Zaballos, and M. Esteban
Human Gene Profiling in Response to the Active Protein Kinase, Interferon-induced Serine/threonine Protein Kinase (PKR), in Infected Cells: INVOLVEMENT OF THE TRANSCRIPTION FACTOR ATF-3 IN PKR-INDUCED APOPTOSIS
J. Biol. Chem., July 7, 2006; 281(27): 18734 - 18745.
[Abstract] [Full Text] [PDF]


Home page