Molecular Cancer Therapeutics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Galligan, L.
Right arrow Articles by Johnston, P. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galligan, L.
Right arrow Articles by Johnston, P. G.
Mol Cancer Ther. 2005;4:2026-2036
© 2005 American Association for Cancer Research

Chemotherapy and TRAIL-mediated colon cancer cell death: the roles of p53, TRAIL receptors, and c-FLIP

Leeona Galligan, Daniel B. Longley, Miranda McEwan, Timothy R. Wilson, Kirsty McLaughlin and Patrick G. Johnston

Centre for Cancer Research and Cell Biology, Queen's University Belfast, Belfast City Hospital, Belfast, United Kingdom

Requests for reprints: Patrick G. Johnston, Centre for Cancer Research and Cell Biology, Queen's University Belfast, University Floor, Belfast City Hospital, Lisburn Road, Belfast, United Kingdom BT9 7AB. Phone: 44-28-90263911; Fax: 44-28-90263744. E-mail: oncology{at}qub.ac.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) has recently attracted attention as a potential therapeutic agent in the treatment of cancer. We assessed the roles of p53, TRAIL receptors, and cellular Fas-associated death domain–like interleukin-1ß-converting enzyme inhibitory protein (c-FLIP) in regulating the cytotoxic effects of recombinant TRAIL (rTRAIL) alone and in combination with chemotherapy [5-fluorouracil (5-FU), oxaliplatin, and irinotecan] in a panel of colon cancer cell lines. Using clonogenic survival and flow cytometric analyses, we showed that chemotherapy sensitized p53 wild-type, mutant, and null cell lines to TRAIL-mediated apoptosis. Although chemotherapy treatment did not modulate mRNA or cell surface expression of the TRAIL receptors death receptor 4, death receptor 5, decoy receptor 1, or decoy receptor 2, it was found to down-regulate expression of the caspase-8 inhibitor, c-FLIP. Stable overexpression of the long c-FLIP splice form but not the short form was found to inhibit chemotherapy/rTRAIL–induced apoptosis. Furthermore, siRNA-mediated down-regulation of c-FLIP, particularly the long form, was found to sensitize colon cancer cells to rTRAIL-induced apoptosis. In addition, treatment of a 5-FU-resistant cell line with 5-FU down-regulated c-FLIP expression and sensitized the chemotherapy-resistant cell line to rTRAIL. We conclude that TRAIL-targeted therapies may be used to enhance conventional chemotherapy regimens in colon cancer regardless of tumor p53 status. Furthermore, inhibition of c-FLIP may be a vital accessory strategy for the optimal use of TRAIL-targeted therapies. [Mol Cancer Ther 2005;4(12):2026–36]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Colorectal cancer remains to be one of the most predominant causes of cancer-related death in the western world. Although the combinations of 5-fluorouracil (5-FU) and oxaliplatin (FOLFOX) or irinotecan (CPT-11; FOLFIRI) have improved response rates to chemotherapy in advanced colorectal cancer (1), resistance to chemotherapy remains a major problem in the treatment of this disease and new approaches are urgently required. Recently, the use of death receptor ligands as novel therapeutic agents has come under scrutiny (2). Tumor necrosis factor–related apoptosis-inducing ligand (TRAIL/Apo2 ligand) was first identified in 1995 due to its sequence homology with other tumor necrosis factor family members (3). TRAIL is a type II membrane protein that can be proteolytically cleaved to a soluble molecule that forms a homotrimeric complex. TRAIL mRNA is abundantly expressed in most normal tissues. However, recombinant soluble human TRAIL (rTRAIL) seems to selectively induce apoptosis in transformed cells but not in most normal cell lines (4). Although the use of the Fas (CD95) death receptor ligand as a systemic therapeutic agent seems to be restricted due to severe liver toxicity, there is growing interest in targeting TRAIL as a therapeutic strategy, as TRAIL has been shown to exert antitumor effects without resulting in serious side effects in several xenograft studies (58). Various TRAIL-targeted therapies are currently in clinical trials.

TRAIL has been shown to bind to five type I transmembrane receptors: death receptor 4 (DR4/TRAIL-R1), death receptor 5 (DR5/TRAIL-R2/KILLER/TRICK2), decoy receptor 1 (DcR1/TRAIL-R3/TRID), decoy receptor 2 (DcR2/TRAIL-R4/TRUNDD), and osteoprotegerin (9). Of these, only DR4 and DR5 contain a functional cytoplasmic death domain that can transmit an intracellular death signal on ligand binding (10, 11). DcR1 and DcR2, which lack or have a truncated death domain, respectively, are termed decoy receptors. They are unable to induce cell death and are thought to block the apoptotic effect of TRAIL and, in DcR2, transduce antiapoptotic signals (12, 13). Binding of TRAIL to either DR4 or DR5 leads to receptor oligomerization and clustering of their intracellular death domains. The adaptor molecule Fas-associated death domain binds to these death domains and, through its NH2-terminal death effector domain, recruits and promotes the proteolytic activation of caspase-8 (Fas-associated death domain–like interleukin-1ß-converting enzyme; refs. 4, 14). Activated caspase-8 in turn activates executioner caspases, such as caspase-3 and caspase-7, leading to cleavage of apoptotic substrates and cell death (15).

Several observations suggest that intracellular molecules inhibit the TRAIL signaling pathway. Firstly, TRAIL, DR4, and DR5 are expressed at significant levels in a wide range of normal tissues that are not sensitive to TRAIL-mediated apoptosis. In addition, expression of DcR1 and DcR2 does not correlate with TRAIL resistance in several in vitro tumor models (16, 17), whereas protein synthesis inhibitors have been shown to sensitize cancer cells to TRAIL-induced apoptosis (1719). The cellular Fas-associated death domain–like interleukin-1ß-converting enzyme inhibitory protein (c-FLIP/Casper/I-Fas-associated death domain–like interleukin-1ß-converting enzyme/FLAME-1/CASH/CLARP/MRIT) has been reported to inhibit death receptor–mediated signaling (20). c-FLIP shows a high level of homology to caspase-8 and caspase-10 but has no protease activity. It inhibits death receptor–mediated apoptosis by binding to Fas-associated death domain and inhibiting caspase-8 activation at the death-inducing signaling complex (20). Of note, c-FLIP overexpression has been observed in some cancers, including colon cancer (21), and c-FLIP protein levels have been shown to correlate with TRAIL resistance in some tumor types (16, 17, 22, 23). Although c-FLIP is expressed as multiple splice variants, two main forms are expressed at the protein level: c-FLIP short form (c-FLIPS), which is 28 kDa in size and contains two death effector domains, and c-FLIP long form (c-FLIPL), which is 55 kDa in size and has two death effector domains and an inactive caspase-like domain (20). Whereas c-FLIPS completely inhibits procaspase-8 activation at the death-inducing signaling complex, c-FLIPL permits partial cleavage of procaspase-8 to an intermediate p41/p43 form but prevents further processing of procaspase-8 to its active p18/p10 subunits.

It has been shown that TRAIL-induced apoptosis can be enhanced by chemotherapy in several in vitro and xenograft models of cancer (2428), an effect reported to be mediated through increased DR4 and DR5 expression (25, 28). In the present study, we have assessed the combined effect of rTRAIL and chemotherapy (5-FU, oxaliplatin, and CPT-11) in a panel of colon cancer cell lines. We found that rTRAIL enhanced apoptosis in response to chemotherapy in all cell lines examined, including a chemotherapy-resistant cell line. Furthermore, this effect was not dependent on functional p53 expression as it was observed in p53 wild-type (WT), mutant, and null cell lines. In addition, the enhanced rTRAIL sensitivity was not due to increased DR4 or DR5 or decreased DcR1 or DcR2 membrane expression following chemotherapeutic drug treatment. In contrast, we found that c-FLIP, particularly c-FLIPL, plays a critical role in regulating TRAIL sensitivity in colon cancer cells following chemotherapy.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
rTRAIL (Calbiochem, Darmstadt, Germany) was resuspended in PBS/0.1% bovine serum albumin as a 20 ng/mL stock solution and stored at –70°C.

Cell Culture
All cells were maintained in 5% CO2 at 37°C. HCT116 p53 WT (p53+/+) and p53 null (p53–/–) isogenic human colon cancer cells were kindly provided by Prof. Bert Vogelstein (Johns Hopkins University, Baltimore, MD) and maintained in McCoy's 5A medium. 5-FU-resistant HCT116 cells were generated and maintained as described previously (29). H630 and HT29 cells (obtained from the National Cancer Institute, Bethesda, MD) and LoVo cells (kindly provided by AstraZeneca, Macclesfield, United Kingdom) were maintained in DMEM. All growth medium was supplemented with 10% dialyzed FCS, 2 mmol/L L-glutamine, and 50 µg/mL penicillin/streptomycin. Additionally, all media, with the exception of that used for LoVo cells, were supplemented with 1 mmol/L sodium pyruvate; all media and supplements were from Invitrogen Life Technologies Corp. (Paisley, United Kingdom).

Generation of c-FLIP-Overexpressing Cell Lines
c-FLIPL and c-FLIPS coding regions were PCR amplified and ligated into the pcDNA/V5-His TOPO vector (Invitrogen Life Technologies) according to the manufacturer's instructions. p53 WT HCT116 cells were cotransfected with 10 µg of each c-FLIP expression construct and 1 µg of a construct expressing a puromycin resistance gene (pIRESpuro3, Clontech, BD Biosciences, Oxford, United Kingdom) using the Genejuice transfection reagent (Merck Biosciences, Darmstadt, Germany). Transfected HCT116 cells were maintained in medium supplemented with 1 µg/mL puromycin (Invitrogen Life Technologies). Stable overexpression of c-FLIP was assessed by Western blot analysis.

siRNA Transfections
siRNAs were designed using the Invitrogen RNA interference designer tool1 to down-regulate both c-FLIP splice variants or to specifically down-regulate the long form or the short form. The sequences used were as follows: splice variant AAGCAGTCTGTTCAAGGAGCA, long form AAGGAACAGCTTGGCGCTCAA, short form AACATGGAACTGCCTCTACTT, and control siRNA AATTCTCCGAACGTGTCACGT. siRNA transfections were done on subconfluent cells incubated in Opti-MEM using the Oligofectamine reagent (both from Invitrogen Life Technologies) according to the manufacturer's instructions.

Western Blot Analysis
Cells were washed in PBS and protein extraction was carried out using egg lysis buffer [20 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, 1 mmol/L EDTA (pH 8.0), 1% Triton X-100, and 0.1% SDS] and standard methodology. Proteins (30 µg) were separated by SDS-PAGE and transferred to a Hybond P membrane (Bio-Rad, Ivry sur Seine, France) by electroblotting. After blocking nonspecific binding sites for 1 hour at room temperature using 5% nonfat milk in PBS-0.3% Tween 20, membranes were incubated with specific primary monoclonal antibodies [poly(ADP-ribose) polymerase (PharMingen, BD Biosciences, Oxford, United Kingdom) and c-FLIP and caspase-8 (Alexis Corp., Lausen, Switzerland)] overnight at 4°C. Membranes were then washed thrice with PBS-0.3% Tween 20 and incubated for a further 2 hours with horseradish peroxidase–conjugated goat anti-mouse antibody (Amersham, Little Chalfont, United Kingdom). Membranes were washed thrice with PBS-0.3% Tween 20 and bands were visualized using the SuperSignal chemiluminescent detection system (Pierce, Rockford, IL). Equal loading was assessed using a ß-tubulin mouse monoclonal primary antibody (Sigma-Aldrich, Dorset, United Kingdom).

Quantitative Reverse Transcription-PCR
HCT116 cells were seeded on P90 plates at 5 x 105 per P90. Twenty-four hours later, cells were treated with 5-FU (5.0 µmol/L), oxaliplatin (0.5 µmol/L), or CPT-11 (5.0 µmol/L) for 24, 48, or 72 hours. Total RNA was extracted using the RNA STAT-60 reagent (Tel-Test, Friendswood, TX), and purified RNA (1 µg) was reversed transcribed using the Moloney murine leukemia virus reverse transcriptase (Invitrogen) according to the manufacturer's instructions. Gene expression was assessed by quantitative PCR using an Opticon II instrument (MJ Research, Waltham, MA) in conjunction with the DYNAmo SYBR Green qPCR kit (Finnzymes, Espoo, Finland) according to the manufacturer's instructions. The primer sequences used were as follows (5'-3'): DR4 forward CATCGGCTCAGGTTGTGGA and reverse TGCCGGTCCCAGCAGACA, DR5 forward CTGCTGTTGGTCTCAGCTGA and reverse TGCCGGTCCCAGCAGACA, and 18S forward CATTCGTATTGCGCCGCTA and reverse CGACGGTATCTGATCGTCT. The following thermal cycling protocol was used for each primer set: an initial denaturation of 94°C for 15 minutes followed by 40 cycles of 94°C for 15 seconds, 58°C for 30 seconds, and 72°C for 1 minute. Analysis of 18S rRNA was used as a loading control.

Flow Cytometric Analysis
Cells were seeded on six-well plates at 2 x 105 per well. For the analysis of DNA content/apoptosis, cells were treated with rTRAIL alone for 24 hours or the indicated doses of chemotherapeutic agent for 24 hours followed by rTRAIL for an additional 24 hours. Cells were harvested and nuclei were stained with propidium iodide. For the analysis of cell surface receptor expression, cells were treated with the indicated doses of chemotherapeutic agent for 48 hours. Cells were then harvested, washed in buffer (PBS with 0.1% sodium azide and 0.2% bovine serum albumin), and stained with phycoerythrin-conjugated DR4, DR5, DcR1, and DcR2 monoclonal antibody (eBiosciences, San Diego, CA) according to the manufacturer's instructions. Nonspecific staining was assessed using a phycoerythrin-conjugated isotype control antibody (eBiosciences). All analysis was carried out on an EPICS XL flow cytometer (Coulter, Miami, FL) using CellQuest software (Pharmingen BD Biosciences).

Clonogenic Survival Assay
To determine the effects of rTRAIL and chemotherapeutic agents on cell proliferation, cells were seeded on 24-well plates at a density of 750 per well. The following day, cells were treated with 5-FU, oxaliplatin, or CPT-11 and 24 hours later with rTRAIL (5 ng/mL). After 72 hours, the growth medium was replaced with fresh medium and cells were allowed to grow for a further 3 to 5 days. Colonies were visualized by crystal violet staining. All cell viability assays were carried out at least thrice.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TRAIL Receptor Expression and Sensitivity to rTRAIL in HCT116 Colon Cancer Cells
The cell surface expression of DR4, DR5, DcR1, and DcR2 was assessed in HCT116 p53+/+ and p53–/– colon cancer cell lines by flow cytometry (Fig. 1A ). Whereas DR5 was highly expressed in both cell lines (84.7% and 86.2% receptor-specific fluorescence compared with isotype control), DR4 and the two TRAIL decoy receptors, DcR1 and DcR2, were not significantly expressed on the cell surface of these cells. Both HCT116 p53+/+ and p53–/– cells were found to be relatively sensitive to rTRAIL by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay with the p53 WT cell line being the more sensitive (Table 1 ). The HCT116 p53+/+ cell line was also found to be more sensitive to rTRAIL by flow cytometry, with a more potent induction of apoptosis observed in this line compared with its p53-null counterpart (Fig. 1B). Furthermore, rTRAIL induced poly(ADP-ribose) polymerase cleavage more potently and at lower concentrations in the p53 WT cell line (Fig. 1C), again indicating that these cells were the more sensitive to rTRAIL.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. TRAIL receptor expression and rTRAIL sensitivity in p53 WT and null HCT116 colon cancer cell lines. A, DR4, DR5, DcR1, and DcR2 membrane expression was assessed by flow cytometry using receptor-specific phycoerythrin-conjugated monoclonal antibodies. Expression was compared with a nonspecific isotype-matched control antibody (Iso control). B, rTRAIL-induced apoptosis in HCT116 p53+/+ (wt) and p53–/– (nl) cells as measured by flow cytometry. The DNA content of propidium iodide–stained cells was analyzed 24 h after treatment with rTRAIL and apoptosis was measured as the percentage of cells in the sub-G0-G1 fraction. Western blot analysis of poly(ADP-ribose) polymerase (PARP) cleavage in rTRAIL-treated HCT116 p53+/+ and p53–/– cells.

 

View this table:
[in this window]
[in a new window]

 
Table 1. rTRAIL IC50 (72 hours) in a panel of colorectal cancer cell lines as measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay

 
Chemotherapy Enhances rTRAIL-Induced Apoptosis
To assess the combined effect of rTRAIL and each chemotherapeutic agent on cell viability in the HCT116 colon cancer cells, we initially used clonogenic survival assays. Colony formation in both p53 WT and null HCT116 cell lines was found to be clearly inhibited to a greater extent in wells cotreated with rTRAIL and chemotherapy than in wells treated with each agent alone, particularly in the p53 WT setting (Fig. 2A ). Our results indicate that combined chemotherapy/rTRAIL treatment results in additive or superadditive inhibition of colony formation in both p53 WT and null HCT116 cell lines. Similar results were obtained using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide cell viability assays (data not shown). The effect of rTRAIL and chemotherapy cotreatment on apoptosis in the HCT116 cells was assessed by flow cytometric analysis (Fig. 2B). In the HCT116 p53+/+ and p53–/– cells, treatment with rTRAIL in combination with each of the three chemotherapies resulted in a greater than additive increase in the percentage of cells undergoing apoptosis than treatment with each agent individually. However, the absolute levels of apoptosis following chemotherapy/rTRAIL cotreatment were lower in the p53-null cell line compared with the p53 WT cell line. Collectively, these results indicate that 5-FU, oxaliplatin, and CPT-11 enhance TRAIL-induced cell death in both p53 WT and null HCT116 cell lines.



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Chemotherapy enhances rTRAIL sensitivity in p53 WT and null HCT116 colon cancer cell lines. A, clonogenic cell survival following drug treatment in the HCT116 p53+/+ and p53–/– cell lines visualized by crystal violet staining. Cells were treated with 5 µmol/L 5-FU, 1 µmol/L oxaliplatin (Oxali), or 5 µmol/L CPT-11 and 5 ng/mL rTRAIL for 72 h, after which time the growth medium was changed and colonies were allowed to grow for a further 4 to 5 d. B, effect of rTRAIL (5 ng/mL) on chemotherapy-induced apoptosis in HCT116 p53+/+ and p53–/– cells as measured by propidium iodide staining and flow cytometry. Cells were pretreated with 5 µmol/L 5-FU, 1 µmol/L oxaliplatin, or 5 µmol/L CPT-11 for 24 h followed by rTRAIL for a further 24 h. For both assays, results are representative of at least three separate experiments.

 
To further examine the role of p53 in TRAIL-mediated apoptosis, we extended our study to a wider panel of colon cancer cell lines. We analyzed cell surface TRAIL receptor expression in H630 cells that contain a deletion in exon 10 of the p53 gene, HT29 cells that contain the "hotspot" p53 R273H mutation, and LoVo cells that express p53 WT (Fig. 3A ). Similar to the HCT116 cell lines, the H630 cells were found to express a relatively high level of DR5 (97.3% receptor-specific fluorescence compared with the isotype control). Furthermore, they also expressed cell surface DR4 (53.8%) and DcR1 (24.2%) but not DcR2. A relatively low level of DR4 (13.8%) and a high level of DR5 (84.8%) expression was detected on the surface of the HT29 cell line. However, these cells did not express significant levels of DcR1 or DcR2. Compared with the other colon cancer cell lines, the LoVo cell line was found to express a lower level of DR5 (33.5%). The LoVo cells also did not express DR4, DcR1, or DcR2. The H630 cell line was found to have a similar sensitivity to rTRAIL as the HCT116–/– cell line, with an IC50 (72 hours) dose of 29 ng/mL; however, the HT29 and LoVo cell lines were found to be highly resistant to rTRAIL with IC50 (72 hours) doses of >200 ng/mL (Table 1). In the H630 and HT29 cell lines, 5-FU, oxaliplatin, and CPT-11 were each found to cause a greater than additive increase in rTRAIL-induced apoptosis, whereas the effects of chemotherapy on rTRAIL-induced apoptosis were more additive in the LoVo cell line (Fig. 3B). These results show that chemotherapy-mediated enhancement of rTRAIL-induced apoptosis occurs in a range of colon cancer cell lines, including p53 null and mutant cell lines. Furthermore, colon cancer cell lines, such as the HT29, which are relatively resistant to rTRAIL as a single agent, can be sensitized to rTRAIL-mediated apoptosis by treatment with chemotherapy.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. TRAIL receptor expression and sensitivity to rTRAIL and chemotherapy in p53 WT (LoVo) and mutant (H630 and HT29) colon cancer cell lines. A, analysis of constitutive DR4, DR5, DcR1, and DcR2 membrane expression in H630, HT29, and LoVo cells as measured by flow cytometric analysis of phycoerythrin-stained cells. B, apoptosis induced by rTRAIL in combination with chemotherapy in H630, HT29, and LoVo cells. Cells were treated with IC50 (72 h) doses of each chemotherapeutic agent for 24 h and then with 10 ng/mL rTRAIL for a further 24 h. The sub-G0-G1 population was quantified by flow cytometric analysis of propidium iodide–stained cells. Representative of at least three separate experiments.

 
Enhancement of Chemotherapy-Induced Apoptosis by rTRAIL Is Not Due to Altered TRAIL Receptor Expression
Expression of DR4 and DR5 mRNA was assessed in the HCT116 cell lines following chemotherapy treatment (Fig. 4A ). 5-FU treatment was found to induce a very modest (~2-fold) increase in DR4 expression in both p53 WT and null cell lines after 48 hours, whereas expression returned to baseline levels at 72 hours. A similar pattern of up-regulation was observed for DR5 expression in the p53 WT cells only. No significant induction of either DR4 or DR5 mRNA expression was observed following oxaliplatin treatment in either cell line. Furthermore, CPT-11 treatment had little effect (<2-fold change) on either DR4 or DR5 mRNA expression in either cell line. Each of the cell lines was also examined for changes in levels of cell surface DR4, DR5, DcR1, and DcR2 following chemotherapy. Interestingly, no significant changes in cell surface expression of either DR4 or DR5 or the decoy receptors were detected in any of the cell lines following drug treatment (Fig. 4B; data not shown). These results indicate that the increased sensitivity to rTRAIL following chemotherapy treatment was not due to increased DR4 or DR5 mRNA expression, nor was it due to increased DR4 or DR5 cell surface expression or to decreased DcR1 or DcR2 cell surface expression.



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. DR4 and DR5 gene expression and TRAIL receptor cell surface expression in chemotherapy-treated colon cancer cell lines. A, relative DR4 and DR5 mRNA expression in HCT116 p53+/+ and HCT116 p53–/– cells was assessed by real-time reverse transcription-PCR following treatment with 5 µmol/L 5-FU, 1 µmol/L oxaliplatin, or 5 µmol/L CPT-11 for 24, 48, and 72 h. B, TRAIL receptor cell surface expression in colon cancer cells following treatment with 5 µmol/L 5-FU, 1 µmol/L oxaliplatin (OXA), or 5 µmol/L CPT-11. Cells were treated with an IC50 dose of each cytotoxic for 48 h, and DR4/DR5, DcR1, and DcR2 membrane expression was assessed in each cell line by flow cytometry. No changes in receptor expression were detected in any cell line on comparison with untreated cells (Control). For each receptor, results from a representative cell line with detectable basal levels of receptor expression are shown.

 
Chemotherapy Down-Regulates c-FLIP Expression in Colon Cancer Cells
As chemotherapy-mediated sensitization of our colon cancer cells to rTRAIL-induced apoptosis did not seem to be facilitated by modulation of TRAIL receptor membrane expression, we turned our attention to expression of procaspase-8 and c-FLIP. The rTRAIL-sensitive H630 cell line expressed ~2-fold higher levels of procaspase-8; however, similar levels of expression were observed in the rTRAIL-sensitive HCT116 cell lines and the rTRAIL-resistant LoVo and HT29 lines (Fig. 5A ). Of note, the expression of c-FLIPS was highest in the two rTRAIL-resistant cell lines HT29 and LoVo, whereas expression of c-FLIPL and c-FLIPS was lowest in the HCT116 p53+/+ cell line, which was the most sensitive to rTRAIL (Fig. 5A; Table 1). These results suggested that c-FLIP expression may play a role in determining sensitivity to rTRAIL in colon cancer cells, so we next assessed the effect of chemotherapy treatment on the expression of c-FLIPL and c-FLIPS in each cell line (Fig. 5B). In HCT116 p53+/+ cells, treatment with 5-FU, oxaliplatin, and CPT-11 resulted in a ~2- to 3-fold decrease in c-FLIPL expression (Fig. 5B). All three chemotherapies also down-regulated c-FLIPS expression in HCT116 p53+/+ cells by at least 3-fold. Treatment with 5-FU, but not oxaliplatin and CPT-11, down-regulated c-FLIPL by ~2-fold in the p53-null HCT116 cell line; however, all three chemotherapies significantly down-regulated c-FLIPS expression (by ~2–3-fold) in this cell line. Similar results were obtained in the other cell lines, as treatment with each chemotherapy resulted in down-regulation of at least one splice form of c-FLIP. These results suggested that down-regulation of c-FLIP expression in response to chemotherapy may play a role in enhancing sensitivity of colon cancer cells to rTRAIL.



View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. c-FLIP expression in colon cancer cell lines. A, constitutive c-FLIP protein and procaspase-8 expression in a panel of colon cancer cell lines as measured by Western blot. B, effect of 5-FU, oxaliplatin, or CPT-11 treatment on c-FLIP expression in a panel of colon cancer cell lines. Cells were treated with IC50 (72 h) doses of each drug for 48 h, and c-FLIPL and c-FLIPS protein expression was assessed by Western blot. For each cell line, the intensity of c-FLIPL and c-FLIPS relative to the control lane was determined by densitometry.

 
c-FLIPL Overexpression Abolishes the rTRAIL Enhancement of Chemotherapy-Induced Apoptosis in Colon Cancer Cells
In light of the effects of chemotherapy on c-FLIP expression in the colon cancer cell lines, we created HCT116 p53+/+ cell models that stably overexpressed either c-FLIPL or c-FLIPS. Following the stable transfection procedure, c-FLIP expression was quantified by Western blot and one c-FLIPL-overexpressing clone (HFL17) and one c-FLIPS-overexpressing clone (HFS19) were selected for subsequent analysis (Fig. 6A ). c-FLIPL overexpression (by ~4-fold) was found to inhibit rTRAIL-mediated apoptosis and abolish the enhanced apoptotic effect observed on dual rTRAIL and cytotoxic drug treatment (Fig. 6B). Somewhat surprisingly, overexpression of c-FLIPS (by ~7-fold) failed to inhibit rTRAIL-induced cell death and did not inhibit apoptosis in response to cotreatment with rTRAIL and chemotherapy (Fig. 6B). Similar results were obtained with other c-FLIP-overexpressing clones (data not shown). Thus, c-FLIPL seems to be a key regulator of apoptosis induced by rTRAIL alone and in combination with chemotherapy treatment.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Overexpression of c-FLIPL inhibits chemotherapy/rTRAIL–induced apoptosis. A, expression of c-FLIPL and c-FLIPS in c-FLIP-overexpressing HCT116 p53+/+ cell lines. B, flow cytometric analysis of apoptosis in c-FLIPL-overexpressing (HFL17), c-FLIPS-overexpressing (HFS19), and control (HLacZ) cell lines pretreated with 5 µmol/L 5-FU, 1 µmol/L oxaliplatin, or 5 µmol/L CPT-11 for 24 h followed by rTRAIL for a further 24 h in comparison with cells treated with each agent alone. The DNA content of propidium iodide–stained cells was assessed. Representative of at least three separate experiments.

 
Down-Regulation of c-FLIP Sensitizes Colon Cancer Cells to rTRAIL-Induced Apoptosis
In addition to assessing the effect of c-FLIP overexpression on TRAIL sensitivity, we used siRNA methodology to down-regulate c-FLIP expression. A siRNA targeted against both c-FLIP splice forms and siRNAs specific for either c-FLIPL or c-FLIPS were designed and transfected into each of the cell lines. c-FLIPL and/or c-FLIPS expression was successfully down-regulated in HCT116 p53+/+, HCT116 p53–/–, H630, and LoVo cells using these siRNAs (Fig. 7A ; data not shown). However, siRNA transfection of HT29 cells was unsuccessful. Simultaneous down-regulation of both c-FLIPL and c-FLIPS (splice variant siRNA) or c-FLIPL alone was found to efficiently sensitize HCT116 p53+/+ cells to rTRAIL-induced apoptosis as assessed by poly(ADP-ribose) polymerase cleavage (Fig. 7B) and flow cytometry (Fig. 7C). Both splice variant and long form siRNAs also sensitized the p53-null HCT116 cell line to rTRAIL. Specific down-regulation of c-FLIPS also sensitized both HCT116 cell lines to rTRAIL but to a lesser extent than in cells transfected with dual-targeted or c-FLIPL-specific siRNAs (Fig. 7B and C). Both splice variant and long form siRNAs were also found to potently sensitize H630 cells to rTRAIL-induced apoptosis, whereas the short form siRNA also sensitized these cells to rTRAIL-induced apoptosis but again to a lesser extent (Fig. 7C). In the LoVo cells, specific down-regulation of c-FLIPL but not c-FLIPS sensitized the cells to rTRAIL (Fig. 7C). These results would suggest that c-FLIP, particularly c-FLIPL, is a key regulator of TRAIL-mediated apoptosis in colon cancer cell lines and that down-regulation of c-FLIP in response to chemotherapy is at least partially responsible for the enhanced sensitivity of chemotherapy-treated colon cancer cells to rTRAIL.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Down-regulating c-FLIP sensitizes colon cancer cells to rTRAIL. A, HCT116 p53+/+ cells were transfected with a nonsilencing control siRNA (SC), a siRNA that targets both long and short c-FLIP isoforms (FT), a c-FLIPL-specific (FL) siRNA, or a c-FLIPS-specific siRNA (FS). All siRNAs were transfected at a final concentration of 1 nmol/L, and the down-regulation of c-FLIP expression was confirmed by Western blot analysis. B, Western blot analysis of poly(ADP-ribose) polymerase cleavage in the HCT116 p53+/+ and p53–/– cells transfected with 1 nmol/L siRNA and cotreated with 2.5 ng/mL rTRAIL for 24 h. C, flow cytometric analysis of apoptosis in HCT116 p53+/+, HCT116 p53–/–, H630, and LoVo cells transfected with 1 nmol/L siRNA and cotreated with 2.5 ng/mL rTRAIL (HCT116 and H630 cell lines) or 10 ng/mL rTRAIL (LoVo cell line) for 24 h. Representative of at least three separate experiments.

 
5-FU Sensitizes a 5-FU-Resistant Cell Line to rTRAIL
We previously generated a 5-FU-resistant HCT116 p53+/+ cell line that is ~3-fold more resistant to 5-FU than the parental cell line (29). We found that this cell line expressed similar levels of DR5 and c-FLIP as the parental line (Fig. 8A and B ) and was equally sensitive to rTRAIL-induced apoptosis (Fig. 8C). Interestingly, despite this cell line being resistant to 5-FU, treatment with 5-FU still significantly sensitized these cells to rTRAIL (Fig. 8D). Furthermore, sensitization of the 5-FU-resistant cells to rTRAIL correlated with a decrease in c-FLIP expression following 5-FU treatment (Fig. 8E). These results suggest that chemotherapy-resistant cells may still be sensitized to rTRAIL by chemotherapy if the chemotherapy treatment results in down-regulation of c-FLIP expression.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 8. Sensitivity of 5-FU-resistant cells to rTRAIL. A, cell surface DR5 expression in HCT116 p53+/+ parental and 5-FU-resistant (5-FURes) cells. B, Western blot analysis of c-FLIP expression in HCT116 p53+/+ parental (Par) and 5-FU-resistant cells. C, flow cytometric analysis of apoptosis in HCT116 p53+/+ parental and 5-FU-resistant cells treated with 10 ng/mL rTRAIL for 24 h. D, flow cytometric analysis of apoptosis in HCT116 p53+/+ parental and 5-FU-resistant cells treated with 5 µmol/L 5-FU for 24 h followed by 2.5 ng/mL rTRAIL for 24 h. E, Western blot analysis of c-FLIP expression in HCT116 p53+/+ parental and 5-FU-resistant cells treated with 2.5 and 5 µmol/L 5-FU for 48 h. The intensity of c-FLIPL and c-FLIPS relative to the control lane was determined by densitometry.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The initial aim of this study was to investigate the apoptotic potential of TRAIL in combination with chemotherapy in in vitro models of colon cancer and, more specifically, to examine the effect of p53 status on potential drug interactions. The p53 WT HCT116 cell line was more sensitive to rTRAIL [IC50 (72 hours), 12 ng/mL] than the p53-null HCT116 daughter cell line [IC50 (72 hours), 25 ng/mL], suggesting that p53 status plays a role in determining the sensitivity of colon cancer cells to TRAIL-mediated apoptosis. However, both p53 mutant HT29 and p53 WT LoVo cell lines were highly resistant to rTRAIL as a single agent [IC50 (72 hours), >200 ng/mL], whereas the p53 mutant H630 cell line was sensitive to rTRAIL [IC50 (72 hours), 29 ng/mL]. Therefore, p53 status is clearly not the sole determining factor of sensitivity TRAIL in colon cancer cells. We also examined cell surface expression of the TRAIL receptors DR4, DR5, DcR1, and DcR2. The three TRAIL-sensitive cell lines (HCT116 p53+/+, HCT116 p53–/–, and H630) expressed a relatively high level of DR5, whereas DR4 was only detected on the cell surface of H630 cells and was expressed at a lower level than DR5. In addition, the H630 cell line was the only one found to express a TRAIL decoy receptor, DcR1, on its cell surface. Interestingly, the p53 WT and null HCT116 cell lines constitutively expressed almost identical levels of cell surface DR5, a reported p53 target gene (30, 31). The TRAIL-resistant line, LoVo, was found to express significantly lower levels of cell surface DR5 than the other cell lines, an observation that may explain their resistance to rTRAIL as a single agent (these cells did not express significant cell surface levels of DR4 or the decoy receptors). Interestingly, the TRAIL-resistant HT29 cell line expressed relatively high levels of DR5 and did not express significant cell surface levels of either decoy receptor. Our findings are consistent with recent evidence that suggests that DR5 may be more significant than DR4 in TRAIL-mediated apoptotic signaling (32). However, expression of DR5 is clearly not the sole determinant of TRAIL sensitivity in colon cancer cells, whereas decoy receptor expression does not seem to play a role in regulating TRAIL sensitivity in colon cancer cell lines. Although procaspase-8 expression was ~2-fold higher in the rTRAIL-sensitive H630 cell line, the levels of procaspase-8 expression were similar in both rTRAIL-sensitive HCT116 cell lines and rTRAIL-resistant LoVo and HT29 lines. This suggests that procaspase-8 expression levels do not determine the relative sensitivity of these cell lines to rTRAIL.

Recent studies have shown that a variety of chemotherapeutic drugs, including cisplatin, etoposide, and doxorubicin, can sensitize a wide range of cancer cells to TRAIL-induced apoptosis (33, 34). Although DR4 and DR5 have been described as p53 target genes, the importance of functional p53 expression in chemotherapy-mediated sensitization to TRAIL-induced apoptosis remains unclear (35). We examined whether chemotherapies used in the treatment of colon cancer (5-FU, oxaliplatin, and CPT-11) augmented the apoptotic effects of rTRAIL in isogenic p53 WT and null HCT116 cell lines. We found that treatment with each chemotherapeutic agent sensitized both p53 WT and null HCT116 cells to rTRAIL-induced apoptosis; however, the p53 WT cell line was the more sensitive to combined rTRAIL/chemotherapy treatment. These results again suggest that p53 plays a role in regulating sensitivity to rTRAIL. HCT116 cells have been reported to be "type II cells" (36), meaning that extrinsic death receptor–mediated apoptotic signal is dependent on amplification through the intrinsic mitochondrial-mediated apoptotic pathway. It is possible that p53-mediated regulation of proapoptotic and antiapoptotic regulators of the intrinsic pathway, such as Bcl-2 and Bax, will increase the sensitivity of HCT116 p53+/+ cells to rTRAIL and combined rTRAIL/chemotherapy treatment compared with the p53-null cell line. Indeed, the proapoptotic Bcl-2 family member Bid, which links the extrinsic and intrinsic apoptotic pathways, has been reported to be a p53 target gene (37). Similarly, the relative sensitivity to rTRAIL and chemotherapy cotreatment of the other colon cancer cell lines examined may also depend on whether they are type I (mitochondria-independent) or type II cells. In the p53 mutant H630 cell line, pretreatment with chemotherapy was found to superadditively enhance rTRAIL-induced apoptosis. Furthermore, chemotherapy pretreatment was found to enhance rTRAIL-induced apoptosis in the two TRAIL-resistant cells lines, HT29 (p53 mutant) and LoVo (p53 WT). As chemotherapy enhanced rTRAIL-induced apoptosis in p53 WT, null, and mutant cell lines, mutant p53 expression, which is commonly observed in colon cancer, may not limit the potential of rTRAIL as a therapeutic agent in the treatment of this disease.

It has been shown previously that various chemotherapeutic agents can induce up-regulation of DR4 and DR5 expression (28, 31, 38). However, we found that chemotherapy treatment had little effect on DR4 and DR5 mRNA levels in either HCT116 p53+/+ and p53–/– cell line, and more significantly, we found that 5-FU, oxaliplatin, or CPT-11 did not modulate DR4 or DR5 cell surface expression following drug treatment in any of the cell lines examined. Furthermore, expression of the TRAIL decoy receptors DcR1 and DcR2 was not affected by chemotherapy treatment. We conclude that modulation of TRAIL receptor expression in response to chemotherapy is not the mechanism by which these colon cancer cell lines are sensitized to rTRAIL.

c-FLIP is a well-documented negative regulator of death receptor–induced apoptosis, the expression of which has been shown to correlate with TRAIL resistance in several types of cancer (17, 20, 39). We found that expression of c-FLIP was lowest in the most TRAIL-sensitive cell line (HCT116 p53+/+) and that c-FLIPS expression was highest in the two most TRAIL-resistant cell lines (LoVo and HT29). These findings suggested that c-FLIP expression may play a role in determining TRAIL sensitivity in colon cancer cells, so we examined the effects of chemotherapy treatment on c-FLIP expression. We found that chemotherapy treatment down-regulated c-FLIPL and/or c-FLIPS protein expression in each cell line. The antiapoptotic role of c-FLIP in regulating TRAIL-mediated apoptosis in colon cancer cells was clearly shown using siRNA methodology. Specific down-regulation of c-FLIPL significantly enhanced the sensitivity of the colon cancer cell lines to rTRAIL, whereas specific down-regulation of c-FLIPS was less effective in sensitizing these cells to rTRAIL. However, with the exception of H630 cells, the levels of apoptosis in cells cotreated with c-FLIP-targeted siRNA and rTRAIL did not reach the levels observed in chemotherapy/rTRAIL–treated cells, suggesting that chemotherapy treatment can also enhance rTRAIL sensitivity by mechanisms other than c-FLIP down-regulation. Our results are similar to those of Sharp et al., who found that down-regulating c-FLIP with siRNA sensitized several cancer cell lines to TRAIL-mediated cell death (40). In their study, one cell line (A549 lung cancer) was more highly sensitized to TRAIL when c-FLIPL was knocked down, whereas others (U2OS osteosarcoma and human 293 embryonic kidney cells) were more highly sensitized to TRAIL when c-FLIPS was knocked down and others (HeLa cervical carcinoma and H460 lung cancer) were equally sensitized to TRAIL by c-FLIPL and c-FLIPS down-regulation. In our study, down-regulation of c-FLIPL consistently resulted in more potent sensitization to rTRAIL than down-regulation of c-FLIPS, suggesting that c-FLIPL is the more important regulator of TRAIL-mediated apoptosis in colon cancer cells. This was further supported by data from c-FLIP-overexpressing cell lines, as overexpression of c-FLIPL, but not c-FLIPS, abolished the sensitivity of the cells to both rTRAIL alone and TRAIL in combination with chemotherapy. Of note, the level of c-FLIPL overexpression in the HFL17 cell line (~4-fold) is similar to the level of overexpression observed by Ryu et al. in colonic tumors (21). Collectively, these studies suggest that c-FLIPL is an important regulator of colon cancer cell death in response to rTRAIL alone and in combination with chemotherapy.

Our results suggest that down-regulation of c-FLIP expression in response to chemotherapy is at least partially responsible for the increased sensitivity of colon cancer cells to rTRAIL-mediated apoptosis. Interestingly, we found that a 5-FU-resistant cell line was also sensitized to rTRAIL by 5-FU, and this correlated with 5-FU treatment causing down-regulation of c-FLIP expression in the resistant cell line. This suggests that chemotherapy-resistant colon cancer cells may still be sensitized to TRAIL-mediated apoptosis by chemotherapy. Given the problems of drug resistance in cancer therapy, this result is highly clinically relevant.

Among the death ligands, TRAIL is showing the most promise as a novel cancer therapy mainly due to its apparent tumor specificity and lack of liver toxicity (41). Agonistic antibodies targeting either DR4 or DR5 are also in development and are showing promise as potential therapeutic agents in the treatment of cancer (42). However, many cell lines derived from a variety of tumor types show resistance to TRAIL-mediated apoptosis, thus limiting the efficacy of TRAIL-based treatment regimens. To date, the basis of TRAIL resistance is not fully elucidated. In this study, we have shown that the differential sensitivity to rTRAIL as a single agent in our panel of colon carcinoma cell lines did not correlate with p53 status. Furthermore, cotreatment with chemotherapy was found to enhance rTRAIL-induced apoptosis in p53 WT, null, and mutant colon cancer cell lines, and this was not due to changes in TRAIL receptor expression following chemotherapy. However, chemotherapy was found to down-regulate expression of the caspase-8 inhibitor c-FLIP. Furthermore, we showed that overexpression of c-FLIPL protected colon cancer cells against apoptosis induced by rTRAIL alone and in the presence of chemotherapy. This is an important observation given in the study by Ryu et al., who found that c-FLIPL is commonly overexpressed in colon cancer (21). Most significantly, down-regulation of c-FLIPL sensitized colon cancer cells to rTRAIL-induced apoptosis. In conclusion, we present evidence that agents that directly or indirectly inhibit or down-regulate c-FLIPL may be important accessory agents for the optimal use of TRAIL and TRAIL receptor–targeted antibodies as therapeutic agents in colorectal cancer.


    Footnotes
 
Grant support: Cancer Research UK, Medical Research Council, Research and Development Office and Department of Health and Social Services, Northern Ireland, and Ulster Cancer Foundation.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: L. Galligan and D.B. Longley contributed equally to this work.

1 https://rnaidesigner.invitrogen.com/rnaiexpress/ Back

Received 7/25/05; revised 9/26/05; accepted 10/19/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Weitz J, Koch M, Debus J, Hohler T, Galle PR, Buchler MW. Colorectal cancer. Lancet 2005;365:153–65.[CrossRef][Medline]
  2. Sheikh MS, Huang Y. Death receptors as targets of cancer therapeutics. Curr Cancer Drug Targets 2004;4:97–104.[CrossRef][Medline]
  3. Wiley SR, Schooley K, Smolak PJ, et al. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 1995;3:673–82.[CrossRef][Medline]
  4. Ashkenazi A, Dixit VM. Apoptosis control by death and decoy receptors. Curr Opin Cell Biol 1999;11:255–60.[CrossRef][Medline]
  5. Ashkenazi A. Targeting death and decoy receptors of the tumour-necrosis factor superfamily. Nat Rev Cancer 2002;2:420–30.[CrossRef][Medline]
  6. Ashkenazi A, Pai RC, Fong S, et al. Safety and antitumor activity of recombinant soluble Apo2 ligand. J Clin Invest 1999;104:155–62.[Medline]
  7. Walczak H, Miller RE, Ariail K, et al. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat Med 1999;5:157–63.[CrossRef][Medline]
  8. Gliniak B, Le T. Tumor necrosis factor-related apoptosis-inducing ligand's antitumor activity in vivo is enhanced by the chemotherapeutic agent CPT-11. Cancer Res 1999;59:6153–8.[Abstract/Free Full Text]
  9. Golstein P. Cell death: TRAIL and its receptors. Curr Biol 1997;7:R750–3.[Medline]
  10. Pan G, Ni J, Wei YF, Yu G, Gentz R, Dixit VM. An antagonist decoy receptor and a death domain-containing receptor for TRAIL. Science 1997;277:815–8.[Abstract/Free Full Text]
  11. Chaudhary PM, Eby M, Jasmin A, Bookwalter A, Murray J, Hood L. Death receptor 5, a new member of the TNFR family, and DR4 induce FADD-dependent apoptosis and activate the NF-{kappa}B pathway. Immunity 1997;7:821–30.[CrossRef][Medline]
  12. Meng RD, McDonald ER, III, Sheikh MS, Fornace AJ, El-Deiry WS. The TRAIL decoy receptor TRUNDD (DcR2, TRAIL-R4) is induced by adenovirus-p53 overexpression and can delay TRAIL-, p53-, and KILLER/DR5-dependent colon cancer apoptosis. Mol Ther 2000;1:130–44.[CrossRef][Medline]
  13. Degli-Esposti MA, Dougall WC, Smolak PJ, Waugh JY, Smith CA, Goodwin RG. The novel receptor TRAIL-R4 induces NF-{kappa}B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 1997;7:813–20.[CrossRef][Medline]
  14. Ashkenazi A, Dixit VM. Death receptors: signaling and modulation. Science 1998;281:1305–8.[Abstract/Free Full Text]
  15. Cohen GM. Caspases: the executioners of apoptosis. Biochem J 1997;326:1–16.[Medline]
  16. Zhang XD, Franco A, Myers K, Gray C, Nguyen T, Hersey P. Relation of TNF-related apoptosis-inducing ligand (TRAIL) receptor and FLICE-inhibitory protein expression to TRAIL-induced apoptosis of melanoma. Cancer Res 1999;59:2747–53.[Abstract/Free Full Text]
  17. Griffith TS, Chin WA, Jackson GC, Lynch DH, Kubin MZ. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J Immunol 1998;161:2833–40.[Abstract/Free Full Text]
  18. Wajant H, Haas E, Schwenzer R, et al. Inhibition of death receptor-mediated gene induction by a cycloheximide-sensitive factor occurs at the level of or upstream of Fas-associated death domain protein (FADD). J Biol Chem 2000;275:24357–66.[Abstract/Free Full Text]
  19. Mori S, Murakami-Mori K, Nakamura S, Ashkenazi A, Bonavida B. Sensitization of AIDS-Kaposi's sarcoma cells to Apo-2 ligand-induced apoptosis by actinomycin D. J Immunol 1999;162:5616–23.[Abstract/Free Full Text]
  20. Irmler M, Thome M, Hahne M, et al. Inhibition of death receptor signals by cellular FLIP. Nature 1997;388:190–5.[CrossRef][Medline]
  21. Ryu BK, Lee MG, Chi SG, Kim YW, Park JH. Increased expression of cFLIP(L) in colonic adenocarcinoma. J Pathol 2001;194:15–9.[CrossRef][Medline]
  22. Poulaki V, Mitsiades CS, Kotoula V, et al. Regulation of Apo2L/tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in thyroid carcinoma cells. Am J Pathol 2002;161:643–54.[Abstract/Free Full Text]
  23. Jonsson G, Paulie S, Grandien A. High level of cFLIP correlates with resistance to death receptor-induced apoptosis in bladder carcinoma cells. Anticancer Res 2003;23:1213–8.[Medline]
  24. Vignati S, Codegoni A, Polato F, Broggini M. TRAIL activity in human ovarian cancer cells: potentiation of the action of cytotoxic drugs. Eur J Cancer 2002;38:177–83.[CrossRef][Medline]
  25. Nagane M, Pan G, Weddle JJ, Dixit VM, Cavenee WK, Huang HJ. Increased death receptor 5 expression by chemotherapeutic agents in human gliomas causes synergistic cytotoxicity with tumor necrosis factor-related apoptosis-inducing ligand in vitro and in vivo. Cancer Res 2000;60:847–53.
  26. Yamanaka T, Shiraki K, Sugimoto K, et al. Chemotherapeutic agents augment TRAIL-induced apoptosis in human hepatocellular carcinoma cell lines. Hepatology 2000;32:482–90.[CrossRef][Medline]
  27. Jin H, Yang R, Fong S, et al. Apo2 ligand/tumor necrosis factor-related apoptosis-inducing ligand cooperates with chemotherapy to inhibit orthotopic lung tumor growth and improve survival. Cancer Res 2004;64:4900–5.[Abstract/Free Full Text]
  28. Gibson SB, Oyer R, Spalding AC, Anderson SM, Johnson GL. Increased expression of death receptors 4 and 5 synergizes the apoptosis response to combined treatment with etoposide and TRAIL. Mol Cell Biol 2000;20:205–12.[Abstract/Free Full Text]
  29. Boyer J, McLean EG, Aroori S, et al. Characterization of p53 wild-type and null isogenic colorectal cancer cell lines resistant to 5-fluorouracil, oxaliplatin and irinotecan. Clin Cancer Res 2004;10:2158–67.[Abstract/Free Full Text]
  30. Takimoto R, El-Deiry WS. Wild-type p53 transactivates the KILLER/DR5 gene through an intronic sequence-specific DNA-binding site. Oncogene 2000;19:1735–43.[CrossRef][Medline]
  31. Wu GS, Burns TF, McDonald ER, III, et al. KILLER/DR5 is a DNA damage-inducible p53-regulated death receptor gene. Nat Genet 1997;17:141–3.[CrossRef][Medline]
  32. Kelley RF, Totpal K, Lindstrom SH, et al. Receptor-selective mutants of Apo2L/TRAIL reveal a greater contribution of DR5 than DR4 to apoptosis signaling. J Biol Chem 2005;280:2205–12.[Abstract/Free Full Text]
  33. Lacour S, Hammann A, Wotawa A, Corcos L, Solary E, Dimanche-Boitrel MT. Anticancer agents sensitize tumor cells to tumor necrosis factor-related apoptosis-inducing ligand-mediated caspase-8 activation and apoptosis. Cancer Res 2001;61:1645–51.[Abstract/Free Full Text]
  34. Xu LH, Deng CS, Zhu YQ, Liu SQ, Liu DZ. Synergistic antitumor effect of TRAIL and doxorubicin on colon cancer cell line SW480. World J Gastroenterol 2003;9:1241–5.[Medline]
  35. Jang SH, Seol JY, Kim CH, et al. Additive effect of TRAIL and p53 gene transfer on apoptosis of human lung cancer cell lines. Int J Mol Med 2004;13:181–6.[Medline]
  36. Ozoren N, El-Deiry WS. Defining characteristics of types I and II apoptotic cells in response to TRAIL. Neoplasia 2002;4:551–7.[CrossRef][Medline]
  37. Sax JK, Fei P, Murphy ME, Bernard E, Korsmayer SJ, El-Deiry WS. Bid regulation by p53 contributes to chemosensitivity. Nat Cell Biol 2002;4:842–9.[CrossRef][Medline]
  38. Wu GS, Burns TF, McDonald ER, III, et al. Induction of the TRAIL receptor KILLER/DR5 in p53-dependent apoptosis but not growth arrest. Oncogene 1999;18:6411–8.[CrossRef][Medline]
  39. Tomek S, Koestler W, Horak P, et al. TRAIL-induced apoptosis and interaction with cytotoxic agents in soft tissue sarcoma cell lines. Eur J Cancer 2003;39:1318–29.[Medline]
  40. Sharp DA, Lawrence DA, Ashkenazi A. Selective knockdown of the long variant of cellular FLICE inhibitory protein augments death receptor-mediated caspase-8 activation and apoptosis. J Biol Chem 2005;280:19401–9.[Abstract/Free Full Text]
  41. Yagita H, Takeda K, Hayakawa Y, Smyth MJ, Okumura K. TRAIL and its receptors as targets for cancer therapy. Cancer Sci 2004;95:777–83.[CrossRef][Medline]
  42. Wajant H, Gerspach J, Pfizenmaier K. Tumor therapeutics by design: targeting and activation of death receptors. Cytokine Growth Factor Rev 2005;16:55–76.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
S. Van Schaeybroeck, D. M. Kelly, J. Kyula, S. Stokesberry, D. A. Fennell, P. G. Johnston, and D. B. Longley
Src and ADAM-17-Mediated Shedding of Transforming Growth Factor-{alpha} Is a Mechanism of Acute Resistance to TRAIL
Cancer Res., October 15, 2008; 68(20): 8312 - 8321.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Zhou, G.-D. Lu, C.-S. Ong, C.-N. Ong, and H.-M. Shen
Andrographolide sensitizes cancer cells to TRAIL-induced apoptosis via p53-mediated death receptor 4 up-regulation
Mol. Cancer Ther., July 1, 2008; 7(7): 2170 - 2180.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Zaman, V. Menendez-Benito, E. Eriksson, A. S. Chagin, M. Takigawa, B. Fadeel, N. P. Dantuma, D. Chrysis, and L. Savendahl
Proteasome Inhibition Up-regulates p53 and Apoptosis-Inducing Factor in Chondrocytes Causing Severe Growth Retardation in Mice
Cancer Res., October 15, 2007; 67(20): 10078 - 10086.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. C. DeRosier, D. J. Buchsbaum, P. G. Oliver, Z.-Q. Huang, J. C. Sellers, W. E. Grizzle, W. Wang, T. Zhou, K. R. Zinn, J. W. Long, et al.
Combination Treatment with TRA-8 Anti Death Receptor 5 Antibody and CPT-11 Induces Tumor Regression in an Orthotopic Model of Pancreatic Cancer
Clin. Cancer Res., September 15, 2007; 13(18): 5535s - 5543s.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Mitchell, P. Kabolizadeh, J. Ryan, J. D. Roberts, A. Yacoub, D. T. Curiel, P. B. Fisher, M. P. Hagan, N. P. Farrell, S. Grant, et al.
Low-Dose BBR3610 Toxicity in Colon Cancer Cells Is p53-Independent and Enhanced by Inhibition of Epidermal Growth Factor Receptor (ERBB1)-Phosphatidyl Inositol 3 Kinase Signaling
Mol. Pharmacol., September 1, 2007; 72(3): 704 - 714.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. R. Wilson, K. M. McLaughlin, M. McEwan, H. Sakai, K. M.A. Rogers, K. M. Redmond, P. G. Johnston, and D. B. Longley
c-FLIP: A Key Regulator of Colorectal Cancer Cell Death
Cancer Res., June 15, 2007; 67(12): 5754 - 5762.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
K. M.A. Rogers, M. Thomas, L. Galligan, T. R. Wilson, W. L. Allen, H. Sakai, P. G. Johnston, and D. B. Longley
Cellular FLICE-inhibitory protein regulates chemotherapy-induced apoptosis in breast cancer cells
Mol. Cancer Ther., May 1, 2007; 6(5): 1544 - 1551.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Galligan, L.
Right arrow