
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Biology and Genetics, Department of Biomedical Sciences and Biotechnology, IDET Centre of Excellence, University of Brescia, Brescia, Italy
Requests for reprints: Sergio Barlati, Division of Biology and Genetics, Department of Biomedical Sciences and Biotechnology, University of Brescia, Viale Europa n.11, 25123 Brescia, Italy. Phone: 0039-030-3717-241; Fax: 0039-030-3701-157. E-mail: barlati{at}med.unibs.it
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The most relevant proteolytical activity of u-PA regards plasminogen, which is converted to the active enzyme, plasmin, which is capable of degrading a broad spectrum of extracellular proteins both by directly degrading extracellular matrix components and by activating collagenases and metalloproteases (8, 9). Also, it is well known that a signal is initiated by the binding of u-PA to u-PAR and transduced to the intracellular compartment by a mechanism not involving plasmin generation. In fact, u-PA/u-PAR system is involved in activating cell signaling pathways, including diacylglycerol formation, activation of a serine kinase, focal adhesion kinase, tyrosine kinase(s), and the activation of transcription pathways (4, 10). u-PA also exerts proliferative actions (11-14) independently of its proteolytic activity. Both the inactivated form of u-PA and the amino-terminal fragment of u-PA molecule (which has no proteolytic activity) are capable of inducing a mitogenic response (15). Furthermore, the u-PA/u-PAR complex has also been shown to be involved in regulating cell migration and adhesion through its interaction with integrins and with vitronectin, an extracellular matrix component (4, 16-18).
Hepatocellular carcinoma (HCC) is an aggressive tumor with a poor prognosis. Many studies of the molecular biology of this tumor have revealed that quantitative and qualitative changes in gene expression occur during its evolution. We have previously shown that u-PA is up-regulated in human tumoral liver tissue and its level of expression is inversely correlated with patients' survival; furthermore, high levels of u-PA mRNA can be considered an unfavorable prognostic marker for HCC patients (19).
In a previous work, we down-regulated u-PA in SKHep1C3 cells, an HCC-derived cell line, by stable expression of antisense RNA technology (20). To avoid possible aspecific responses by the cells resulting in cytotoxicity and apoptosis following transfection or intracellular production of RNA duplex longer than about 30 nucleotides (nt; refs. 21-23), we successfully used a recent technological breakthrough that allows delivery of short dsRNA, small interfering RNA (siRNA), by a plasmid into eukaryotic cells to down-modulate u-PA expression (24-30).
In this study, we transfected SKHep1C3 cells with a plasmid in which we cloned DNA fragments that acted as templates for the synthesis of siRNAs under the control of the U6 promoter. The resulting RNA was composed of two identical 19-nt sequence motifs in an inverted orientation, separated by a 9-bp spacer to form a hairpin dsRNA capable of mediating target u-PA inhibition via posttranscriptional gene silencing. The results obtained confirm and demonstrate that the proliferative, invasive, and migrative capabilities of HCC cells can be reduced by u-PA target siRNA. Blocking of u-PA expression by siRNA could be a direct approach for reducing both the proteolytical and the signal transduction activity of the enzyme.
| Materials and Methods |
|---|
|
|
|---|
Design and Preparation of Constructs
For design siRNA targeting u-PA, a DNA sequence of the type AA(N19) was selected. This sequence (AACATTCACTGGTGCAACTGC) corresponded to nucleotides 208 to 228 of the human u-PA mRNA (National Center for Biotechnology Information access number: A35395). Synthetic sense and antisense oligonucleotides (Sigma-Genosys, The Woodlands, TX) constitute the template for generating RNA composed of two identical 19-nt sequence motifs in an inverted orientation, separated by a 9-bp spacer to form a double strand hairpin of siRNA. Two micrograms of each oligonucleotide were annealed for 3 minutes at 90°C and for 1 hour at 37°C and then ligated into 2 µg of pSILENCER 1.0-U6 plasmid (containing ampicillin resistance gene and the mouse U6 RNA Polymerase III promoter; Ambion, Woodward, Austin, TX) linearized with ApaI and EcoRI (Fig. 1). The construct was cloned in TOP10 chemically competent Escherichia coli, according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). The sequence of the insert was confirmed by automated sequencing and by analyzing the fragments generated from digestion with HindIII.
|
Transfected cells were selected for blasticidine resistance (6 µg/mL; pS: cells transfected with vector-alone; pS siRNA u-PA: cells transfected with siRNA u-PA construct).
| DNA Extraction |
|---|
|
|
|---|
Reverse Transcription-PCR Analysis
Total RNA of transfected SKHep1C3 was extracted, quantified, and reverse transcribed as described (32). The following reverse transcription (RT)-PCR was done to determine the percentage of u-PA mRNA inhibition: 2 µg of total RNA were reverse transcribed using u-PART (5'-ATGCTGCAGAATAAGTACATTC-3') specific reverse primer in the 3' UTR of u-PA mRNA, and the amplification reaction was done essentially as described previously (33). In parallel, the same amount from the same preparation of total RNA was retrotranscribed using random examers to verify the integrity of RNA and adequate cDNA synthesis using glyceraldehyde-3-phosphate dehydrogenase 1/2 (GAPDH1/2) specific primers. Quantification of the ribosomal protein L7, phosphoglycerate kinase 1 (PGK1), and ß-actin expression was also done using specific primers (20).
Endogenous u-PA was detected by PCR analysis (conducted on cDNA specific for u-PA) with u-PAE/u-PAF; u-PAE: 5'-TCCTGACTCAACATGTTACTGAC-3' (nt 1583 to 1605); u-PAF: 5'-ATACATTCATGGAATATCAGAGC-3' (nt 1846 to 1868). A comparative PCR method was used to determine the percentage of inhibition of u-PA, together with an image analysis system (IAS) able to scan the PCR amplified products directly from the images of the agarose gel bands, thus, obtaining a relative quantification of the u-PA products in comparison with the expression level of u-PA in SkHep1C3 untransfected cells. The relative values were expressed in pixels as integrated density (19).
Immunofluorescence
For the immunofluorescence detection of u-PA, u-PAR, and GAPDH, SKHep1C3 and SKHep1C3transfected cells were seeded (40,000 cells/22 x 22 mm glass coverslips in 3-cmdiameter Petri dishes) and treated according to the standard protocol described previously (34). The cultures were fixed in cold methanol and then immunoreacted with the first antibodies, polyclonal antibodies anti-human u-PA (TechnoClone, Vienna, Austria), anti-GAPDH (Chemicon International, Temecula, CA), and anti-u-PAR (mouse monoclonal anti-u-PAR antibodies were kindly provided by Prof. F. Blasi, DIBIT, Istituto Scientifico San Raffaele, Milan, Italy). The cells were then immunoreacted with the secondary antibodies fluorescein-conjugated anti-rabbit IgG and rhodamine-conjugated anti-mouse IgG (Calbiochem, San Diego, CA; ref. 33). The coverslips were mounted on glass slides in mounting medium and photographed with a Leitz fluorescence microscope (x100 magnification). Ten randomly chosen fields were analyzed for each cell type with a specific analysis system (IAS) program to evaluate the integrated optical density level of each immunofluorescent cell. Analysis of variance was done considering SKHep1C3, pS and pS siRNA u-PA, u-PAR, and GAPDH integrated optical density levels. The data were considered to be significant when P
0.05.
Western Blot Analysis and Zymography
The conditioned media were prepared and analyzed by Western blotting, as described previously (34). The 24-hour serum-free conditioned media (2 mL/6-cmdiameter Petri dish) were collected from confluent cultures of parental, pS, and pS siRNA u-PAtransfected cells. Constant amounts of proteins (19.8 µg) from conditioned media of transfected and non-transfected cells were loaded in SDS-PAGE, under non-reducing conditions, on a polyacrylamide gel composed of three layers, containing different acrylamide concentrations at 4%, 6%, and 12%. Gel was blotted on nitrocellulose membranes and immunoreacted with rabbit anti-human u-PA antibodies (1:1,000 in 1% bovine serum albumin) or overlaid onto casein agar containing 2 µg/mL of human plasminogen (TechnoClone) to evaluate u-PA activity (20). Proteins (19.8 µg) from conditioned media of transfected and non-transfected cells were also loaded on an 8% polyacrylamide gel, electroblotted onto a nitrocellulose membrane, and immunoblotted using goat polyclonal antibodies anti-PAI-1 (1:500 in 0.3% bovine serum albumin) and alkaline phosphatase-conjugated anti-goat IgG (1:7,500 v/v) to verify constant amount of loaded proteins.
The cell extracts were prepared as described (34, 35). Constant amounts of proteins (12.6 µg/well) were loaded on an 8% polyacrylamide gel. The separated proteins were electroblotted onto a nitrocellulose membrane, then immunoblotted using mouse monoclonal antibodies anti-GAPDH (1:300 in 1% bovine serum albumin) and alkaline phosphatase-conjugated anti-mouse IgG, rabbit polyclonal antibodies anti-protein kinase R (anti-PKR), anti-phospo-PKR (Thr 446/451), anti-eIF
(eIF2
:
subunit of eukaryotic initiation factor 2), anti-phospho-eIF
(Ser51; 1:1,000 in 5% bovine serum albumin; Cell Signaling Technology, Beverly, MA), and alkaline phosphatase-conjugated anti-rabbit IgG.
The positive immunoreaction was detected with nitroblue tetrazolium and bromochloroindolyl phosphate (Promega, San Diego, CA). The bands were scanned by a digital system (IAS) and the values of integrated density were expressed in pixels (34). The amount of u-PA protein in SKHep1C3 untransfected cells was considered as 100%.
Invasion and Motility
Invasion and motility assays were done in a 24-well transwell chamber (Costar, Bodenheim, Germany). The 8-µm pore inserts were coated with 15 µg of Matrigel (Becton Dickinson Labware, Bedford, MA). Cells were added to coated filters (2 x 105 cells/filter) in 100 µL of serum-free medium in triplicate wells. In the lower compartments of the chambers, a volume of 600 µL of AB5 human fibroblast-serum-free-conditioned media was used as chemoattractant. After 24 hours at 37°C in a 5% CO2 incubator, the Matrigel coating on the upper surface of the filter was wiped off using a cotton swab. Cells that migrated through the filters were fixed, stained with Hema-3, photographed, and counted.
The motility assay was conducted in a similar fashion but without coating with Matrigel. Cells (1 x 105/filter) were loaded on transwell polycarbonate membrane inserts in triplicate wells. The plates were incubated for 24 hours at 37°C in a 5% CO2 incubator, then the cells in the lower wells were fixed, stained with Hema-3, and counted. The cells that had migrated to the lower compartment of the chambers were trypsinized and counted. Each experiment was carried out in triplicate. The statistical significance of the results was calculated using the ANOVA procedure. The data were considered to be significant when P
0.05.
Proliferation Assay
SKHep1C3 and SKHep1C3-transfected cells were seeded (1.25 x 104 cells/dish) in triplicate in 3-cmdiameter Petri dishes. After 24, 48, and 72 hours of incubation at 37°C, the cells were trypsinized and counted using a Burker chamber.
| Results |
|---|
|
|
|---|
RT-PCR Analysis of u-PA Expression
Molecular characterization of parental (SKHep1C3) and transfected cells (pS and pS siRNA u-PA) was carried out by semiquantitative RT-PCR analysis of u-PA mRNA expression. Following standardization for the level of GAPDH, detected at comparable levels in all cell lines (Fig. 2B), u-PA mRNA was found to be markedly reduced in pS siRNA u-PA cells, whereas pS cells showed substantially the same levels of parental cell u-PA mRNA (Fig. 2A). Other mRNAs, such as ß-actin, ribosomal protein L7, and phosphoglycerate kinase 1 (PGK1), were found to be comparable in all three cell lines (Fig. 2C-E).
|
|
subunit of eukaryotic initiation factor 2 (eIF2
), the levels of phosphorylated and unphosphorylated forms of PKR and of eIF2
were examined in transfected and in non-transfected cells. Western blot analysis of PKR (Mr = 74,000) and eIF2
(Mr = 40,000) showed similar levels in non-transfected and transfected cells; the lack of phosphorylation of PKR together with the lack of phosphorylation of eIF2
excludes the activation of PKR cell signaling pathway in siRNA u-PAtransfected cells (Fig. 4).
|
|
|
To determine changes in the growth pattern of SKHep1C3 cells stably transfected with siRNA u-PA, a growth curve was done on them along with parental cells and the cells transfected with the empty vector. u-PA inhibition by siRNA u-PA transfection modulated the proliferation of hepatocellular carcinoma cells; in fact, the proliferation of pS siRNA u-PA cells was markedly decreased compared with parental and vector-alonetransfected cells (P < 0.05) (Fig. 6C), thus, indicating u-PA involvement in the proliferative potential of hepatocarcinoma cells.
| Discussion |
|---|
|
|
|---|
There is considerable evidence of an association between u-PA expression and the mitogenic activity of the cells (36, 37). In vitro studies have shown that u-PA acts as an autocrine mitogen in human melanoma cells (11). In addition, exogenous u-PA induces the proliferation and growth of cells of various origins (12, 13).
We have previously shown that u-PA gene transcription is up-regulated in human HCC tissues and that high levels of u-PA mRNA can be considered an unfavorable prognostic marker for HCC patients (19, 38). RNA duplexes of 19 to 23 nt (called siRNAs) have recently been shown to mediate the inhibition of gene expression: this mechanism is called RNA interference (RNAi; refs. 24, 29, 30). RNAi has rapidly become a functional genomics tool in a broad range of species; it has been used for transient or stable knock down of gene expression in cell lines and very recently in experimental animal models. Several genes have been successfully knocked down by RNAi in mammalian cells due to improved siRNA delivery systems, and attention is now turning to verification of the potential of RNAi as a tool for gene therapy (39, 40). RNAi has the greatest impact as an experimental therapeutic approach in two clinical areas: cancer and infective diseases.
In this work, we down-modulated u-PA via siRNA stable expression strategy in SKHep1C3 hepatocarcinoma-derived cell line, characterized by high levels of u-PA mRNA expression. This approach may provide important evidence of the role of u-PA in specific malignant properties of HCC-derived cells. The production and the secretion of u-PA were greatly reduced in siRNA u-PAtransfected cells compared with control cells. Significant inhibition of u-PA protein production was found despite reduced inhibition of mRNA u-PA expression.
In our system, the lack of phosphorylation of PKR and the lack of phosphorylation of eIF2
in siRNA u-PAtransfected cells, verified by immunoblotting analysis, excludes activation of the IFN pathway. Reduction of u-PA protein was not due to a non-specific inhibition of translation via the PKR pathway. At the mRNA level, RT-PCR expression of four housekeeping genes has been found to be constant in transfected and in non-transfected cells. All these data indicate that the decrease of target u-PA seems to be specific. The mechanism of action of siRNA in mammalian cells has as yet been poorly investigated. Some authors suggest that siRNAs might work as microRNAs (41), which knock down gene expression not only via mRNA degradation but also/or via translation arrest. This is probably due to imperfect pairing between antisense strand of microRNA/siRNA and mRNA that does not allow mRNA cleavage; the result is a block in the translation process (41). Additional mechanisms such as changes in DNA methylation or chromatin structure may also be involved (42). For all these reasons, RNAi studies are now proceeding in two directions: to understand the mechanism of action of siRNA in mammalian cells and to test more therapeutic applications.
In our system, the amount of u-PAR protein, detected by immunofluorescence analysis, was also shown to be lower in siRNA u-PAtransfected cells. Our results are in line with what is known about the ability of u-PA to up-regulate the expression of its cellular receptor at a transcriptional level, by increasing the activity of the transcriptional factor Sp1, and also at a posttranscriptional level, by promoting u-PAR mRNA stability (43, 44). There is considerable evidence that the u-PA/u-PAR system plays a role in tumor cell proliferation (45, 46). In our study, we observed that siRNA u-PAtransfected cells were characterized by reduced proliferation.
In summary, we have shown that inhibition of endogenous u-PA using siRNA technology reduced the motility, invasion, and proliferation of HCC cells. Many authors have shown that the u-PA system is a therapeutic target for a variety of human tumors, not only for HCC (1, 47), and our results obtained using RNAi technology provide further support. Some authors have used RNAi in liver disease, but as yet only one group has directly transfected siRNA oligos in HCC-derived cells targeting cyclin E, which controls the progression from G1 to S phase and when overexpressed is involved in carcinogenesis of HCC (48). Other authors have investigated the effect of RNAi activity on the replication of HCV (49) and HBV (50) viruses, which are responsible for hepatitis C and B, respectively. The results showed a sharp reduction in the levels of replicative intermediates and viral protein. To our knowledge, this is the first report of inhibition of u-PA in HCC tumorigenic cells using RNAi technology. Although we obtained comparable u-PA inhibition with plasmid expressing antisense u-PA mRNA, the advantages provided by siRNA technology should be relevant for in vivo studies avoiding aspecific defense responses against duplex RNA longer than 30 nt (21-23).
In conclusion, our findings confirm that down-modulation of u-PA may be an effective way of achieing a significant reduction in the malignant properties of HCC-derived cells and the results obtained from siRNA u-PA technologies may be of help in designing and testing in vivo anti-invasive therapeutic strategies.
| Acknowledgments |
|---|
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 12/30/03; revised 2/27/04; accepted 4/ 2/04.
| References |
|---|
|
|
|---|
Vß3. Int J Cancer 2001;91:300-8.[CrossRef][Medline]
Andreasen PA, Kjoller L, Christensen L, Duffy MJ. The urokinase-type plasminogen activator system in cancer metastasis: a review. Int J Cancer 1997;72:1-22.[CrossRef][Medline]
Ossowski L. Plasminogen activator dependent pathways in the dissemination of human tumor cells in the chick embryo. Cell 1988;52:321-8.[CrossRef][Medline]
Barlati S. Plasminogen activators and fibronectin fragments in tumor growth and signal transduction. Bull Inst Pasteur 1994;92:269-75.
Murakami K, Sakukawa R, Ikeda T, et al. Invasiveness of hepatocellular carcinoma cell lines: contribution of membrane-type 1 matrix metalloproteinase. Neoplasia 1999;1:424-30.[CrossRef][Medline]
Blasi F. The urokinase receptor and cell migration. Semin Thromb Hemost 1996;22:513-6.[Medline]
Kirchheimer JC, Wojta J, Christ G, Binder BR. Functional inhibition of endogenously produced urokinase decreases cell proliferation in a human melanoma cell line. Proc Natl Acad Sci USA 1989;86:5424-8.This article has been cited by other articles:
![]() |
S. M. K. Pulukuri, B. Gorantla, and J. S. Rao Inhibition of Histone Deacetylase Activity Promotes Invasion of Human Cancer Cells through Activation of Urokinase Plasminogen Activator J. Biol. Chem., December 7, 2007; 282(49): 35594 - 35603. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhu, V. M. Gokhale, L. Szabo, R. M. Munoz, H. Baek, S. Bashyam, L. H. Hurley, D. D. Von Hoff, and H. Han Identification of a novel inhibitor of urokinase-type plasminogen activator Mol. Cancer Ther., April 1, 2007; 6(4): 1348 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. K. Pulukuri, N. Estes, J. Patel, and J. S. Rao Demethylation-Linked Activation of Urokinase Plasminogen Activator Is Involved in Progression of Prostate Cancer Cancer Res., February 1, 2007; 67(3): 930 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Epstein and T. W. Leung Reversing Hepatocellular Carcinoma Progression by Using Networked Biological Therapies Clin. Cancer Res., January 1, 2007; 13(1): 11 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Pulukuri, C. S. Gondi, S. S. Lakka, A. Jutla, N. Estes, M. Gujrati, and J. S. Rao RNA Interference-directed Knockdown of Urokinase Plasminogen Activator and Urokinase Plasminogen Activator Receptor Inhibits Prostate Cancer Cell Invasion, Survival, and Tumorigenicity in Vivo J. Biol. Chem., October 28, 2005; 280(43): 36529 - 36540. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Cell Growth & Differentiation |