
Mol Cancer Ther. 2004;3:425-435
© 2004 American Association for Cancer Research
The histone deacetylase inhibitor suberic bishydroxamate regulates the expression of multiple apoptotic mediators and induces mitochondria-dependent apoptosis of melanoma cells
Xu Dong Zhang,
Susan K. Gillespie,
Jodie M. Borrow and
Peter Hersey
Immunology and Oncology Unit, Royal Newcastle Hospital, Newcastle, New South Wales, Australia
Requests for Reprints Peter Hersey, Immunology and Oncology Unit, Royal Newcastle Hospital, Room 443, David Maddison Clinical Sciences Building, Corner King and Watt Streets, Newcastle, New South Wales 2300, Australia. Phone: 61-2-49-236828; Fax: 61-2-49-236184. E-mail: Peter.Hersey{at}newcastle.edu.au
 |
Abstract
|
|---|
Histone deacetylase (HDAC) inhibitors have attracted much interest because of their ability to arrest cell growth, induce cell differentiation, and in some cases, induce apoptosis of cancer cells. In the present study, we have examined a new HDAC inhibitor, suberic bishydroxamate (SBHA), for its effect on a panel of human melanoma cell lines. We report that it induces varying degrees of apoptosis in the melanoma lines but not in melanocytes and fibroblasts. Induction of apoptosis was caspase dependent and was associated with induction of changes in mitochondrial membrane permeability, which could be inhibited by overexpression of Bcl-2. The changes in mitochondria were independent of caspase activation and were associated with changes in conformation of Bax. SBHA down-regulated several key antiapoptotic proteins including X-linked inhibitor of apoptosis and the Bcl-2 family proteins, Bcl-XL and Mcl-1. In contrast, it induced up-regulation of the Bcl-2 family proapoptotic proteins, Bim, Bax, and Bak. In addition, SBHA induced relocation of the protein Bim to mitochondria and its association with Bcl-2. De novo protein synthesis was required for initiation of apoptosis in that the protein synthesis inhibitor, cycloheximide, inhibited SBHA-induced conformational changes in Bax as well as changes in mitochondrial membrane permeability and activation of caspase-3. These results suggest that SBHA induces apoptosis by changing the balance between proapoptotic and antiapoptotic proteins in melanoma cells. The protein Bim may be a key initiator of apoptosis in cells treated with SBHA.
 |
Introduction
|
|---|
Histones are basic proteins that, by complexing with DNA, form nucleosomes leading to the compact structure of chromatin. Basic amino acids of the histones can be post-translationally modified with methyl, acetyl, or phosphate groups. The balance between histone acetylation and deacetylation regulated by histone acetyltransferase and histone deacetylases (HDACs) plays an important role in transcriptional regulation of genes (15). Acetylation of lysine residues of histones results in more open chromatin structure and activation of transcription, whereas hypoacetylation of histones is associated with a condensed chromatin structure resulting in the repression of gene transcription (4, 5). Inhibition of HDAC activity by HDAC inhibitors results in the accumulation of acetylated histones leading to altered transcription of several genes (6). This has been demonstrated to arrest cell growth (79) and to reverse neoplastic characteristics by inducing differentiation (1013). In addition, HDAC inhibitors can induce apoptotic cell death in a variety of tumor cell lines (12, 1416). HDAC inhibitors are therefore considered to be promising chemotherapeutic agents for treatment of malignant tumors. The potential significance of HDAC inhibitors as anticancer agents has been supported by studies in animal models and clinical trails showing antitumor activity with minor toxicity to normal tissues in vivo (17, 18).
Although several HDAC inhibitors have been shown to induce apoptosis of cultured tumor cells, the mechanism(s) underlying this appears to vary considerably. For example, explanations for the induction of apoptosis by the HDAC inhibitor sodium butyrate include alterations in Bcl-2 family protein expression (1922), increased caspase activity (20), increased sensitivity to Fas/Fas ligand interaction (23, 24), and changes in the expression of genes such as c-myc and k-ras (25). Moreover, caspase-independent mechanisms have also been suggested as causative (21). It appeared that sodium butyrate-induced apoptosis was mediated through the mitochondrial pathway in that apoptosis was inhibitable by overexpression of Bcl-XL (21). Studies with another HDAC inhibitor, apicidin, showed that this was associated with translocation of Bax to mitochondria and subsequent release of cytochrome c (26).
In the present study, we have examined the apoptosis-inducing potential of a new HDAC inhibitor, suberic bishydroxamate (SBHA), in human melanoma cell lines and dissected the SBHA-mediated apoptotic signaling pathway. We report that SBHA induces varying degrees of apoptosis in the majority of melanoma cell lines, but not in melanocytes and fibroblasts, via a mitochondrion-dependent pathway that is associated with relocation of Bax to mitochondria. SBHA down-regulated the antiapoptotic proteins Bcl-XL, Mcl-1, and X-linked inhibitor of apoptosis (XIAP) but up-regulated the proapoptotic proteins Bim, Bak, and Bax and, to a lesser extent, Bid, caspase-8, and caspase-3. The BH3-only protein Bim translocated to mitochondria and was associated with Bcl-2 in cells treated with SBHA. Initiation of apoptotic signaling requires de novo protein synthesis in that the protein synthesis inhibitor cycloheximide (CHX) inhibited SBHA-induced changes in Bax and mitochondria, caspase-3 activation, and apoptosis. These results are consistent with induction of apoptosis by changing the balance between proapoptotic and antiapoptotic proteins in melanoma cells. Activation of the BH3-only protein Bim may be the initiating factor of apoptosis in cells treated with SBHA.
 |
Materials and Methods
|
|---|
Cell Lines
Human melanoma cell lines Me4405, Me1007, IgR3, Mel-FH, Mel-RMu, Mel-RM, Mel-CV, and MM200 have been described previously (27, 28). Melanocytes were kindly provided by Dr. P. Parson (Queensland Institute of Medical Research, Brisbane, Queensland, Australia) and cultured in medium supplied by Clonetics (Edward Kellar, Victoria, Australia). Human lung fibroblasts MRC-5 were obtained from Bio Whittaker (Walkersville, MD) and cultured in DMEM containing 5% FCS (Commonwealth Serum Laboratories, Melbourne, Victoria, Australia).
Antibodies, Recombinant Proteins, and Other Reagents
SBHA was a kind gift from Dr. Parson. It was dissolved in distilled water and made up in a stock solution of 10 mg/ml. The cell-permeable pan-caspase inhibitor Z-Val-Ala-Asp(OMe)-CH2F (z-VAD-fmk), caspase-9 inhibitor Z-Leu-Glu(OMe)-His-Asp(OMe)-CH2F (z-LEHD-fmk), and caspase-3 inhibitor Z-Asp(OMe)-Glu(OMe)-Val-Asp(OMe)-CH2F (z-DEVD-fmk) were purchased from Calbiochem (La Jolla, CA). The rabbit polyclonal antibodies against caspase-3, caspase-8, and Bid, the mouse monoclonal antibodies (mAbs) against cytochrome c, poly(ADP-ribose)polymerase (PARP), p21WAF1/CIP1, p27Kip1, and cyclin A, and the rabbit mAb against the active form of caspase-3 were purchased from PharMingen (Bioclone, Marrickville, New South Wales, Australia). The rabbit polyclonal antibodies against inhibitor of caspase-activated DNase (ICAD) and Bak and the mouse mAbs against Bcl-2, Bcl-XL, Mcl-1, and Bax were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The mouse mAb against XIAP was purchased from Transduction Laboratories (Lexington, KY). The rabbit polyclonal antibody against Smac/DIABLO was from Calbiochem. The rabbit polyclonal antibody against cleaved caspase-9 was purchased from New England Biolabs (Beverly, MA). The rabbit polyclonal anti-Bax against amino acids 120 was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). The rabbit polyclonal antibody against Bim was from Imgenex (San Diego, CA). The mAb against cytochrome c oxidase subunit 4 (COX IV) was purchased from Molecular Probes (Eugene, OR). Isotype control antibodies used were the ID4.5 (mouse IgG2a) mAb against Salmonella typhi supplied by Dr. L. Ashman (Institute for Medical and Veterinary Science, Adelaide, South Australia, Australia), the 107.3 mouse IgG1 mAb purchased from PharMingen (San Diego, CA), and the rabbit immunoglobulin from Sigma Chemical Co. (Castle Hill, New South Wales, Australia).
Plasmid Vector and Transfection
Stable Mel-RM transfectants of Bcl-2 were established by electroporation of the PEF-puro vector carrying human Bcl-2 provided by Dr. David Vaux (Walter and Eliza Hall Institute, Melbourne, Victoria, Australia) and described elsewhere (28).
Flow Cytometry
Immunostaining on intact and permeabilized cells was carried out as described previously (27, 28).
Apoptosis
Quantitation of apoptotic cells by the propidium iodide method was carried out as described elsewhere (27, 28). 4',6-Diamidino-2-phenylindole (DAPI) staining was performed according to the manufacturer's instructions (Molecular Probes). Melanoma cells were seeded onto sterile coverslips in 24-well plates (Becton Dickinson, Lane Cove, New South Wales, Australia) overnight. Cells with or without treatment with SBHA for a further 24 h were washed with PBS, fixed with 3.7% paraformaldehyde, and stained with DAPI (300 nM) for 5 min. Coverslips were mounted in Gel-Mount (Biomedia, Foster City, CA) and examined using a Zeiss Axiophot microscope (Oberkochem, Germany).
Mitochondrial Membrane Potential
Tumor cells were cultured in 24-well plates and allowed to reach exponential growth for 24 h before treatment. MitoTracker Red CMXRos (Molecular Probes) was added at 100 nM during the last 30 min of treatment. The medium was removed into a 75-mm Falcon polystyrene tube (Becton Dickinson, Sunnyvale, CA) and the adherent cells were trypsinized and collected into the same tube. After washing with PBS, the cells were analyzed using a FACScan flow cytometer (Becton Dickinson, Sunnyvale, CA) for MitoTracker uptake. Untreated cells were used as controls.
Western Blot Analysis
Methods used were as described previously (27, 28). The densities of the Western blot bands in some experiments were quantitated on a Macintosh computer using the public domain NIH Image Program, which is available on the Internet (http://rsb.info.nih.gov/nih-image).
Immunoprecipitation
Methods used were as described previously with minor modification (28). Briefly, 100 µl of lysates were precleared by incubation with 20 µl of a mixture of protein A-Sepharose and protein G-Sepharose packed beads (Santa Cruz Biotechnology) in a rotator at 4°C for 2 h and then with 20 µl of fresh packed beads in a rotator at 4°C overnight. Twenty micrograms of anti-Bcl-2 mAb or control immunoglobulin was then added to the lysate and rotated at 4°C for 2 h. The beads were then pelleted by centrifugation and washed five times with ice-cold lysate buffer before elution of the proteins from the beads in lysate buffer at room temperature for 1 h. The resulted immunoprecipitates were then subjected to SDS-PAGE and Western blot analysis.
Preparation of Mitochondrial and Cytosolic Fractions
Methods used for subcellular fraction were similar to the methods described previously (28).
Real-Time PCR
Total RNA was isolated with SV Total RNA Isolation System (Promega, Sydney, New South Wales, Australia). Reverse transcription-PCR (RT-PCR) was carried out using Moloney murine leukemia virus transcriptase and Oligo d(T) and the resulting cDNA products were used as templates for real-time PCR assays. Real-time RT-PCR was performed using the ABI Prism 7700 Sequence Detection System (PE Applied Biosystems, Scoresby, Victoria, Australia). Twenty-five microliters of mixture were used for reaction, which contains 5 µl cDNA sample (0.51 µg/µl), 300 nM forward primers for Bcl-XL (GGTCGCATTGTGGCCTTT) or Bax (TGGAGCTGCAGAGGATTG), 300 nM reverse primers for Bcl-XL (TCCTTGTCTACGCTTTCCACG) or Bax (GAAGTTGCCGTCAGAAAACATG), 200 nM probes for Bcl-XL (VIC-ACAGTGCCCCGCCGAAGGAGA-TAMRA) or Bax (VIC-AGAGGTCTTTTTCCGAGTGGCAGCTG-TAMRA), and 9 mM MgCl2. The probe was designed to cross the boundary of intron and exon of Mcl-1 cDNA. Analysis of cDNA for ß-actin was included as a control. After incubation at 50°C for 2 min followed by 95°C for 10 min, the reaction was carried out for 40 cycles of the following: 95°C for 15 s and 60°C for 1 min. The threshold cycle value was normalized against ß-actin cycle numbers. The relative abundance of mRNA expression of a control sample was arbitrarily designated as 1 and the values of the relative abundance of mRNA of other samples were calculated accordingly.
 |
Results
|
|---|
SBHA Induces Apoptosis of Melanoma Cells
We examined the apoptosis-inducing potential of SBHA in melanoma cells by treating IgR3 and Mel-RM cells with a range of concentrations of the compound for 24 h. As shown in Fig. 1A, SBHA induced apoptosis of the melanoma cells even when used at concentrations as low as 10 µg/ml with the percentage of apoptotic cells peaking at 30 µg/ml for Mel-RM. Figure 1B shows the representative flow cytometry histograms of propidium iodide staining. Apoptosis was confirmed by visualization of DNA fragmentation by DAPI staining (Fig. 1C). Figure 1D shows that while apoptosis could be detected by 12 h after treatment in both IgR3 and Mel-RM cells, the kinetics differed between the two lines. The percentage of apoptotic cells in Mel-RM peaked at 24 h after treatment, whereas the kinetics of apoptosis of IgR3 cells appeared markedly delayed with a peak being observed at 48 h. As shown in Fig. 1E, there was a wide variation in sensitivity of melanoma cells to SBHA-induced apoptosis with negligible cell death in MM200 but nearly 50% apoptotic cells in Mel-RM cells. SBHA did not induce apoptosis in melanocytes and fibroblasts (Fig. 1E) even when the cells were treated for prolonged periods (data not shown).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 1. SBHA induces apoptosis of melanoma. A, titration of SBHA on induction of apoptosis. IgR3 and Mel-RM cells were treated with SBHA at indicated doses for 24 h before assay of apoptosis by the propidium iodide method using flow cytometry. Data are representative of three individual experiments. B, representative flow cytometry histograms of apoptosis assays by the propidium iodide method. IgR3 and Mel-RM cells were treated with SBHA at 30 µg/ml for 24 h. C, representative microphotographs of DAPI staining. IgR3 and Mel-RM cells were treated with SBHA at 30 µg/ml for 24 h. Arrows, apoptotic cells. D, kinetics of induction of apoptosis by SBHA. IgR3 and Mel-RM cells were exposed to SBHA at 30 µg/ml at the indicated time periods before assay of apoptosis by the propidium iodide method using flow cytometry. Data are representative of three individual experiments. E, SBHA induced apoptosis in a panel of melanoma cell lines but not in melanocytes and MRC-5 fibroblasts. Cells were treated with SBHA at 30 µg/ml for 24 h and apoptosis was measured by the propidium iodide method using flow cytometry. Columns, mean of three individual experiments; bars, SE.
|
|
Induction of Apoptosis of Melanoma by SBHA Is Caspase Dependent
Figure 2, A and B, shows that the pan-caspase inhibitor, z-VAD-fmk, completely inhibited SBHA-induced apoptosis, whereas a caspase-3 specific inhibitor, z-DEVD-fmk, partially inhibited SBHA-induced apoptosis. The involvement of the caspase cascade in SBHA-induced apoptosis was confirmed by examining caspase-3 activation status in IgR3 and Mel-RM cells using a mAb that specifically recognizes the active form of caspase-3 as shown in Fig. 2, C and D. Caspase-3 was activated by 12 h with peak activation at 16 h after exposure to SBHA. Analysis of caspase-3 activation in Western blots showed that cleavage of the proenzyme form of caspase-3 appeared later than that detected by flow cytometry with degradation of procaspase-3 being detected at 48 h in IgR3 cells and 24 h in Mel-RM cells after exposure to SBHA (Fig. 2E). A slight increase in the procaspase-3 levels was detected in both cell lines at 3 h after SBHA treatment (Fig. 2E).

View larger version (53K):
[in this window]
[in a new window]
|
Figure 2. Induction of apoptosis by SBHA is caspase dependent. A and B, inhibition of SBHA-induced apoptosis by a pan-caspase inhibitor, z-VAD-fmk (A), or a caspase-3 inhibitor, z-DEVD-fmk (B). Mel-RM and IgR3 cells were treated with either z-VAD-fmk (20 µM) or z-DEVD-fmk (30 µM) 1 h before adding SBHA (30 µg/ml) for another 24 h. Apoptosis was measured by the propidium iodide method using flow cytometry. Columns, mean of three individual experiments; bars, SE. C, representative flow cytometry histograms of assays of caspase-3 activation induced by SBHA. Mel-RM and IgR3 cells were treated with SBHA (30 µg/ml) for 16 h before activated form of caspase-3 was measured in permeabilized cells using flow cytometry. Filled histograms, isotype controls. D, kinetics of SBHA-induced caspase-3 activation. Mel-RM and IgR3 cells were treated with SBHA (30 µg/ml) at the indicated time periods. Caspase-3 activation was measured as described in C. Data are representative of three individual experiments. E, SBHA induced cleavage of procaspase-3, ICAD, and PARP. Mel-RM and IgR3 cells were treated with SBHA (30 µg/ml) at the indicated time periods. Whole cell lysates were subjected to Western blot analysis. Western blot analysis of ß-actin levels was included to show that equivalent amounts of protein were loaded in each lane. F, inhibition of SBHA-induced apoptosis by a caspase-9 inhibitor, z-LEHD-fmk. Mel-RM and IgR3 cells were treated with z-LEHD-fmk (30 µM) 1 h before adding SBHA (30 µg/ml) for another 24 h. Apoptosis was measured by the propidium iodide method using flow cytometry. Columns, mean of three individual experiments; bars, SE. G, SBHA induced caspase-9 activation but not cleavage of caspase-8, Bid, and caspase-2. Mel-RM and IgR3 cells were treated with SBHA (30 µg/ml) at the indicated time periods. Whole cell lysates were subjected to Western blot analysis using an antibody that specifically recognizes the cleaved form of capsase-9 and antibodies against procaspase-8, Bid, and procaspase-2, respectively. Western blot analysis of ß-actin levels was included to show that equivalent amounts of protein were loaded in each lane.
|
|
Figure 2E shows that SBHA induced cleavage of the long form of ICAD (ICADL) in Mel-RM cells by 16 h and it was barely detectable by 24 h. In contrast, reduction in ICADL in IgR3 cells was only evident by 48 h after treatment. Figure 2E also shows that there was nearly complete disappearance of PARP expression at 16 and 24 h after SBHA treatment in Mel-RM cells and the p85 fragment of cleaved PARP was clearly detected. PARP cleavage was however only detected in IgR3 cells at 24 and 48 h.
Inhibition of caspase-9 activity by treatment of cells with a caspase-9 specific inhibitor, z-LEHD-fmk, 1 h before the addition of SBHA almost completely blocked SBHA-induced apoptosis in melanoma cells (Fig. 2F). Caspase-9 activation by SBHA was confirmed by using an antibody that specifically recognizes the p38 fragment of the cleaved caspase-9. As shown in Fig. 2G, treatment of IgR3 and Mel-RM cells for up to 6 h resulted in weak expression of the cleaved caspase-9, but at 16 and 24 h, there was a marked increase in the expression levels. Procaspase-8 was increased in Mel-RM by 6 h after exposure to SBHA and remained relatively stable thereafter (Fig. 2G). Only small increases in procaspase-8 were seen in the IgR3 cell line. The p43 and p18 cleaved forms of caspase-8 were not detected (data not shown). Figure 2G also shows that the expression of Bid was slightly up-regulated in Mel-RM cells by 6 h but was less evident in IgR3 cells after treatment with SBHA. The truncated form of Bid was not detected after treatment with SBHA (data not shown). The levels of expression of procaspase-2 remained unchanged in melanoma cells before and after treatment with SBHA (Fig. 2G).
SBHA Induces Changes in Mitochondrial Membrane Permeability
The activation of caspase-9 suggested that SBHA may be acting to induce changes in mitochondrial membrane permeability leading to release of mitochondrial apoptogenic proteins. Figure 3A shows that treatment of melanoma cells with SBHA induced varying degrees of changes in the mitochondrial membrane potential (
m) in melanoma cells, which were detectable at 12 h and peaked at 16 h after exposure to SBHA. As shown in Fig. 3B, inhibition of caspase activity had no effect on changes in 
m induced by SBHA. Fig. 3C shows that after exposure to SBHA for 16 h, both cytochrome c and Smac/DIABLO were observed in the cytosolic fractions with a corresponding decrease in the mitochondrial fractions. Release of cytochrome c and Smac/DIABLO were caspase independent as shown in Fig. 3D.
Overexpression of Bcl-2 Inhibits SBHA-Induced Apoptosis of Melanoma
To confirm the role of mitochondria in SBHA-induced apoptosis, we transfected cDNA encoding Bcl-2 into Mel-RM cells (Fig. 4A). Figure 4B shows that the levels of SBHA-induced apoptosis in Bcl-2 transfected cells were markedly decreased compared with those in vector alone transfected cells. As shown in Fig. 4C, SBHA-induced changes in the 
m were reversed in Bcl-2-transfected cells but not in cells transfected with the vector alone. Similarly, SBHA-induced caspase-3 activation was also inhibited by Bcl-2 overexpression (Fig. 4D). Consistent with this, cleavage of ICAD and PARP by SBHA treatment was almost completely blocked in Bcl-2 overexpressing cells (Fig. 4E).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 4. Overexpression of Bcl-2 suppresses SBHA-induced apoptotic events. A, Bcl-2 was overexpressed in Mel-RM cells transfected with the cDNA encoding Bcl-2 but not in the cells transfected with the vector alone. Whole cell lysates were subjected to Western blot analysis. Western blot analysis of ß-actin levels was included to show that equivalent amounts of protein were loaded in each lane. Data are representative of two individual experiments. B, overexpression of Bcl-2 inhibited apoptosis induced by SBHA. Mel-RM cells transfected with cDNA for Bcl-2 or vector alone were treated with SBHA (30 µg/ml) for 24 h before assay of apoptosis by the propidium iodide method using flow cytometry. Columns, mean of three individual experiments; bars, SE. C, Overexpression of Bcl-2 inhibited changes in the  m induced by SBHA. Mel-RM cells transfected with cDNA for Bcl-2 or vector alone were treated with SBHA (30 µg/ml) for 16 h before the  m was measured by uptake of the MitoTracker Red CMXRos using flow cytometry. Columns, mean of three individual experiments; bars, SE. D, overexpression of Bcl-2 inhibited caspase-3 activation induced by SBHA. Mel-RM cells transfected with cDNA for Bcl-2 or vector alone were treated with SBHA (30 µg/ml) for 16 h before activated form of caspase-3 was measured in permeabilized cells using flow cytometry. Columns, mean of three individual experiments; bars, SE. E, overexpression of Bcl-2 inhibited cleavage of PARP and ICAD induced by SBHA. Mel-RM cells transfected with cDNA for Bcl-2 or vector alone were treated with SBHA (30 µg/ml) for 24 h before harvest. Whole cell lysates were subjected to Western blot analysis. Western blot analysis of ß-actin levels was included to show that equivalent amounts of protein were loaded in each lane. Data are representative of two individual experiments.
|
|
SBHA Induces Changes in the Conformation of Bax and Its Relocation from the Cytosol to Mitochondria
Bax translocation from the cytosol to mitochondria is believed to play a key role in induction of apoptosis by a variety of apoptotic stimuli (29). Bax translocation involves a conformational change that exposes the NH2 terminus and the hydrophobic COOH terminus that targets mitochondria (30, 31). We studied the conformation status of Bax in melanoma cells with or without exposure to SBHA by using an antibody directed against the NH2-terminal region of Bax in flow cytometry (32, 33). As shown in Fig. 5A, after exposure to SBHA for 16 h, there was a marked increase in Bax that had undergone conformational changes. The degree of increase in mean fluorescence intensity varied considerably among the cell lines with a marked increase in Me1007, IgR3, Mel-CV, Mel-RM, and MM200 but only minor changes in Me4405, Mel-RMu, and Mel-FH. This was clearly correlated with the levels of apoptosis induced by SBHA (Fig. 5, B and C).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 5. SBHA induced a conformational change of Bax and its relocation from the cytosol to mitochondria. A, representative flow cytometry histograms of assays of induction of a conformational change of Bax by SBHA. Mel-RM and IgR3 cells with or without treatment with SBHA (30 µg/ml) for 16 h were subjected to flow cytometry analyses using a Bax NH2-terminal epitope-specific antibody in permeabilized cells. B, induction of the conformational change of Bax by SBHA in a panel of melanoma cell lines. Cells were treated and assays were carried out as described in A. Columns, mean of three individual experiments; bars, SE. C, correlation of the levels of increases in the conformational change of Bax and the levels of SBHA-induced apoptosis. Regression analyses were carried out in a Macintosh computer using the StatView software. D, induction of the conformational change of Bax is independent of caspases. Mel-RM and IgR3 cells were treated with z-VAD-fmk (20 µM) 1 h before adding SBHA (30 µg/ml) for another 16 h. The conformational change of Bax was measured as described in A. Data are representative of two individual experiments. E, overexpression of Bcl-2 did not inhibit the conformational change of Bax. Mel-RM cells transfected with cDNA for Bcl-2 or vector alone were treated with SBHA (30 µg/ml) for 16 h before the Bax conformation change was measured as described in A. Data are representative of two individual experiments. F, relocation of Bax from the cytosol to mitochondria. Mel-RM and IgR3 cells were treated with SBHA (30 µg/ml) for 12 h before harvest. The mitochondrial and cytosolic fractions were subjected to Western blot analyses. Western blot analysis of COX IV levels was included to show relative purity of the mitochondrial fractions. Data are representative of two individual experiments.
|
|
Figure 5D shows that conformational changes in Bax induced by SBHA could not be inhibited by pretreatment with z-VAD-fmk. Similarly, studies on Bcl-2-transfected Mel-RM cells indicated that overexpression of Bcl-2 had only a minor effect on induction of conformational changes in Bax by SBHA (Fig. 5E). These results suggest that the conformational changes in Bax were upstream of changes in mitochondrial membrane permeability and activation of caspases.
We confirmed the role of Bax in SBHA-induced apoptosis of melanoma by examining the expression of Bax in different subcellular fractions of IgR3 and Mel-RM cells with or without exposure of cells to SBHA. As shown in Fig. 5F, before treatment, the Bax protein was predominantly in the cytosol with only a negligible amount being detected in the mitochondrial fractions. In contrast, 12 h after treatment with SBHA, a considerable amount of Bax was observed in the mitochondrial fractions with a corresponding decrease in the expression in the cytosol.
SBHA Down-Regulates Members of the Antiapoptotic Bcl-2 Family and XIAP but Up-Regulates Proapoptotic Bcl-2 Family Members
We evaluated expression of the antiapoptotic proteins Bcl-XL, Bcl-2, and Mcl-1 together with the proapoptotic proteins Bax, Bak, and Bim in IgR3 and Mel-RM cells after treatment with SBHA at 30 µg/ml for varying time periods. As shown in Fig. 6A, Bcl-XL expression was markedly down-regulated as early as 3 h. When the density of the bands was quantitated, the levels of Bcl-XL expression appeared to be down-regulated by 98% in IgR3 cells and by 92% in Mel-RM cells by 6 h after incubation with SBHA. The expression of Mcl-1 was up-regulated at 3 and 6 h but was down-regulated thereafter. In contrast, no changes in the overall protein levels of Bcl-2 were observed even at 24 h after treatment. The expression levels of the multidomain proapoptotic Bcl-2 family members Bax and Bak were up-regulated with a peak being observed at 24 h. By 6 h after the addition of SBHA, the levels of Bax expression were increased by 54% for IgR3 cells and by 43% for Mel-RM cells and the levels of Bak expression were increased by 106% for IgR3 cells and by 168% in Mel-RM cells. Bim, a BH3-only protein of the Bcl-2 family, was markedly up-regulated with expression peaking at 16 h after exposure to SBHA. By 6 h after treatment with SBHA, the levels of Bim were up-regulated by 165% for IgR3 cells and by 210% for Mel-RM cells. Figure 6A also shows that the expression of XIAP, an important inhibitor of apoptosis in melanoma cells (28), was markedly down-regulated in a time-dependent manner after treatment with SBHA. The expression levels of XIAP at 6 h after exposure to SBHA were about 2550% less than those before treatment.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 6. Regulation of the expression of Bcl-2 family members and XIAP in melanoma cells. A, whole cell lysates from Mel-RM and IgR3 cells with or without treatment with SBHA (30 µg/ml) at the indicated time periods were subjected to Western blot analyses. Data are representative of two individual experiments. B and C, SBHA down-regulates the Bcl-XL mRNA levels but up-regulates the Bax mRNA levels. Mel-RM and IgR3 cells were treated with SBHA (30 µg/ml) for 6 h before total RNA was isolated and subjected to real-time PCR analyses. Columns, mean of three individual experiments; bars, SE.
|
|
To determine if the alterations in the protein expression levels of Bcl-2 family were related to changes in expression of their mRNA, Bcl-XL and Bax mRNA expression levels in IgR3 and Mel-RM melanoma cells were quantitated by real-time RT-PCR before and after exposure of cells to SBHA for 6 h. Figure 6B shows that the level of Bcl-XL mRNA expression was down-regulated by 83% in IgR3 and by 74% in Mel-RM cells at 6 h after treatment with SBHA. In contrast, Bax mRNA expression was up-regulated by 24% in IgR3 and by 37% in Mel-RM cells (Fig. 6C). These results suggest that alterations in Bcl-2 family protein expression may be due to the regulation of transcription by SBHA. Changes in Bcl-XL and Bax mRNA expression levels could not be observed during induction of apoptosis by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a member of the tumor necrosis factor family that is known to induce apoptosis in Mel-RM and IgR3 cells (Refs. 27, 28; data not shown).
SBHA Induces Translocation of Bim to Mitochondria and Its Association with Bcl-2
Up-regulation of the BH3-only protein Bim is of particular interest as it mediates apoptosis in response to a variety of apoptotic stimuli (3439). Under normal condition, BimL and BimEL interact with the dynein light chain, thus being sequestered at microtubules away from mitochondria (34). However, certain apoptotic stimuli can free Bim from the dynein motor complex, allowing it to translocate to mitochondria and bind to Bcl-2 (34, 37). As shown in Fig. 7A, before treatment with SBHA, there was little, if any, Bim in mitochondria. In contrast, Bim was readily detected in mitochondrial fractions from both Mel-RM and IgR3 cells at 6, 12, and 16 h after treatment with SBHA but not with TRAIL (data not shown).

View larger version (66K):
[in this window]
[in a new window]
|
Figure 7. SBHA induced translocation of Bim to mitochondria and its association with Bcl-2. A, mitochondrial fractions from Mel-RM and IgR3 cells with or without treatment with SBHA at 30 µg/ml at the indicated time periods were subjected to Western blot analysis. Western blot analysis of COX IV levels was included to show relative purity of the mitochondrial fractions. Data are representative of two individual experiments. B, whole cell lysates from Mel-RM cells and Mel-RM Bcl-2 transfectants with or without treatment with SBHA at 30 µg/ml for 6 h were subjected to immunoprecipitation with a mouse mAb against Bcl-2. The precipitates were subjected to SDS-PAGE and probed with the mAb against Bcl-2 and an antibody against Bim, respectively. Western blot analysis of ß-actin levels was included to show that equivalent amounts of protein were loaded in each lane. Data are representative of two individual experiments. C, Mel-RM cells with or without pretreatment with z-VAD-fmk (20 µM) for 1 h were treated with SBHA at 30 µg/ml for 6 h. Whole cell lysates were subjected to immunoprecipitation with a mouse mAb against Bcl-2. The precipitates were subjected to SDS-PAGE and probed with an antibody against Bim. Western blot analysis of ß-actin levels was included to show that equivalent amounts of protein were loaded in each lane. Data are representative of two individual experiments.
|
|
To test if Bim is physically associated with Bcl-2, we precipitated Bcl-2 in whole cell lysates from Mel-RM and Mel-RM Bcl-2 transfectants before and after treatment with SBHA. Resulting precipitates were analyzed by Western blot for Bcl-2 and Bim expression. Figure 7B shows that there was little association between Bim and Bcl-2 before treatment. In contrast, by 6 h after exposure to SBHA, they were clearly coprecipitated in both Mel-RM parental cells and Mel-RM cells overexpressing Bcl-2. The association of Bim with Bcl-2 in Bcl-2 transfectants after treatment with SBHA suggests that up-regulation and translocation of Bim is caspase independent in that Bcl-2 overexpression blocked caspase activation induced by SBHA. We confirmed this by coprecipitation of Bim and Bcl-2 in whole cell lysates from Mel-RM cells treated with SBHA in the presence of z-VAD-fmk, as shown in Fig. 7C. This suggests that activation and relocalization of Bim occurred upstream of caspase activation during the initiation of apoptosis. Bim could not be detected in precipitates from cells treated with TRAIL for the same time periods (data not shown).
De Novo Protein Synthesis Is Required for Induction of Apoptosis by SBHA
To determine if macromolecular synthesis is required for induction of apoptosis by SBHA, we examined the effects of the protein synthesis inhibitor, CHX, on SBHA-induced apoptotic events. As shown in Fig. 8, A and B, CHX at concentrations ranging from 100 ng/ml to 1 µg/ml markedly inhibited SBHA-induced apoptosis, with maximal inhibitory effect and lowest toxicity when used at 100 ng/ml. CHX lost its inhibitory effects when used at concentrations lower than 100 ng/ml and had no impact on SBHA-induced apoptosis when used at 5 ng/ml. Figure 8, C and D, shows that the conformational change of Bax and caspase-3 activation induced by SBHA were inhibited by CHX at a concentration of 100 ng/ml.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 8. Induction of apoptosis by SBHA requires de novo protein synthesis. Mel-RM (A) and IgR3 (B) cells were treated with combinations of SBHA at 30 µg/ml and CHX at concentrations indicated for 24 h before assay of apoptosis by the propidium iodide method using flow cytometry. Data are representative of three individual experiments. C, Mel-RM and IgR3 cells treated with SBHA (30 µg/ml), CHX (100 ng/ml), or combination of both for 16 h were subjected to flow cytometry analyses using a Bax NH2-terminal epitope-specific antibody in permeabilized cells. Data are representative of three individual experiments. D, Mel-RM and IgR3 cells treated with SBHA (30 µg/ml), CHX (100 ng/ml), or combination of both for 16 h were subjected to flow cytometry analyses using a mAb against the activated form of caspase-3 in permeabilized cells. Data are representative of three individual experiments.
|
|
 |
Discussion
|
|---|
SBHA is a relatively new HDAC inhibitor that has been the subject of studies on cell division (40) and fetal globin gene expression (41), but relatively little is known about its ability to induce apoptosis in cancer cells or the mechanisms involved. In the present studies, we show that it induced varying degrees of apoptosis in eight of nine human melanoma lines but did not induce apoptosis in normal melanocytes and fibroblasts. Apoptosis occurred relatively late (2448 h) after the addition of the drug and was dependent on induction of mitochondrial membrane permeability as shown by failure of SBHA to induce apoptosis in melanoma cells overexpressing Bcl-2. Apoptosis was caspase dependent and correlated with SBHA-induced conformational changes in the proapoptotic Bax protein. Of particular note, SBHA induced changes in expression of several proapoptotic and antiapoptotic proteins that are known to regulate the mitochondrial apoptotic pathway.
Involvement of the mitochondrial apoptotic pathway was shown by the changes in the 
m associated with release of cytochrome c and Smac/DIABLO and activation of caspase 9. These changes and the downstream events were inhibitable by overexpression of Bcl-2. The role of mitochondria in SBHA-induced apoptosis was further shown by the findings that a caspase-9 specific inhibitor blocked SBHA-induced apoptosis. It is now widely believed that apoptosis acting via the mitochondrial pathway is dependent on the balance between the proapoptotic BH3-only Bcl-2 family members and the antiapoptotic Bcl-2 family members. The proapoptotic BH3 proteins include Bid (activated by caspase 8), Bim or Bmf [transcriptionally regulated or released from damage to microtubules (34, 37) or the actin myoskeleton (42)], and Noxa or Puma [up-regulated by gene transcription resulting from activation of p53 (43, 44)]. The antiapoptotic Bcl-2 family members include Bcl-2, Bcl-XL, and Mcl-1. Bcl-2 and, to a lesser extent, Bcl-XL are bound to mitochondria and other membranes in the cells and bind any BH3-only proteins released into the cytosol (45). Should the concentration of BH3 proteins exceed that of the antiapoptotic proteins, Bax and Bak undergo changes in conformation that allow them to aggregate in mitochondrial membranes and induce release of apoptosis-inducing factors (46), such as cytochrome c and Smac/DIABLO.
Treatment with SBHA resulted in conformational changes in Bax and its relocation from the cytosol to mitochondria. This was not inhibited by a pan-caspase inhibitor, which suggests that the changes in Bax were upstream of changes in mitochondrial membrane permeability and activation of caspases. We examined which particular BH3 protein(s) may be involved in activation of Bax. There was no evidence that Bid was activated by SBHA and caspase-8 inhibitors did not block apoptosis. Noxa or Puma were not detected by Western blotting or in immunoprecipitation studies and Bmf was not detected by Western blot studies (data not shown). Changes in mRNA for Noxa/Puma or Bmf were also not detected (data not shown). In contrast, Bim was readily detected by Western blotting and treatment with SBHA was associated with an increase in its concentration. Moreover, SBHA induced relocation of Bim from cytosolic fractions to mitochondria and its association with Bcl-2. These changes were independent of caspase activation and appeared to precede changes in conformation of Bax and changes in mitochondrial membrane permeability. More definitive proof that Bim is the key initiator is the subject of ongoing studies.
In addition to Bim, the multidomain Bax and Bak proteins were also up-regulated. At the same time, there was a marked decrease in the antiapoptotic Bcl-XL, Mcl-1, and XIAP proteins. These changes and the relatively slow onset of apoptosis induced by SBHA lead us to hypothesize that SBHA may induce apoptosis by transcriptional regulation of genes rather than the more rapid direct effects on existing caspases or post-translational effects on existing proapoptotic proteins. This was supported by changes in mRNA expression studied by real-time PCR, showing down-regulation of mRNA for Bcl-XL and up-regulation of mRNA for Bax. The changes in the expression of multiple apoptotic mediators did not appear to be the consequences of the apoptotic cascade itself because they occurred prior to the onset of changes in mitochondria, caspase-3 activation, and apoptosis. Studies with the protein synthesis inhibitor CHX also suggested that new protein synthesis was required in that activation of caspase-3, changes in Bax, and mitochondrial membrane permeability were inhibited by treatment with CHX.
SBHA-induced excess of BH3 proteins (Bim) over Bcl-2 antiapoptotic proteins (Bcl-XL and Mcl-1) may provide the conditions needed for induction of a conformational change in Bax and consequent changes in mitochondrial membrane permeability and apoptosis. Although Bim can be released from microtubules by apoptotic initiators such as UV irradiation (34), it is also transcriptionally regulated [e.g., by the forkhead transcription factor FKHR-L1 (47, 48) and FoxO (49)]. The increase in transcriptional up-regulation of Bim might therefore be sufficient to induce apoptosis in cells with low levels of certain Bcl-2 family proteins. Down-regulation of Bcl-XL gene expression has been reported to lead to apoptosis in mesothelioma cells by another HDAC inhibitor, sodium butyrate (21). Similarly, transcriptional down-regulation of Bcl-2 by sodium butyrate appeared to be responsible for apoptosis induction in MCF-7 breast cancer, mesothelioma, and prostate cancer cells (19, 20, 22). However, down-regulation of Bcl-XL observed in the present study is not likely to be the initiating factor in induction of apoptosis in melanoma cells by SBHA because new protein synthesis is clearly required for apoptosis induction as evidenced by studies using CHX. Up-regulation of the multidomain proapoptotic proteins of the Bcl-2 family Bax and Bak by SBHA may facilitate apoptosis induction as they are absolutely required to induce mitochondrial dysfunction by BH3-only proteins. Moreover, down-regulation of XIAP in melanoma cells by SBHA may accelerate the activation of caspase-9 and enhance caspase-3 activity, thus promoting apoptosis induction (28).
Another hydroxamic acid HDAC inhibitor, suberoylanilide hydroxamic acid (SAHA), was reported to induce apoptosis by direct cleavage of Bid (50). In the present study, Bid was slightly up-regulated, but its cleavage was not detected following treatment with SBHA. Apoptosis induced by SAHA appeared to be caspase independent, whereas apoptosis induced by SBHA was dependent on activation of caspases (50). The apoptotic pathway induced by SBHA may therefore be novel and complementary to other apoptosis-inducing agents. It is however noteworthy that the differences between SBHA and other HDACs in induction of apoptosis may be merely due to the differences in cell types used in the different studies (1922, 50). Considering the importance of BH3-only proteins in initiating apoptosis, it would be of interest to examine in future studies if up-regulation and activation of Bim is involved in induction of apoptosis in melanoma cells by other HDACs such as sodium butyrate and SAHA.
The mechanism by which SBHA regulates such a diverse array of genes involved in apoptosis is not clear. The balance between histone acetylation and deacetylation plays an important role in transcriptional regulation of genes (15). Likely, SBHA targets HDACs associated with transcriptional factors that are involved in regulation of apoptosis such as p53 or c-Myc. The forkhead transcription factors FKHR-L1 and FoxO have both been reported to regulate transcription of Bim (4749). Down-regulation or up-regulation of other genes by HDAC inhibitors has been reported by others (6, 25, 51). SBHA up-regulates the expression levels of p21 in melanoma cells as do other HDACs (data not shown). However, a complete profile of its target enzyme specificities and its effects on gene expression remain to be elucidated. Further studies are in progress to explore the effects of SBHA on gene transcription.
The complementary proapoptotic changes induced in several different proteins involved in apoptosis makes SBHA potentially important as an anticancer agent (e.g., in combination with chemotherapeutic agents that induce other proapoptotic BH3-only proteins such as Noxa/Puma or Bmf or in combination with TRAIL to induce activation of Bid). Melanocytes and fibroblasts were not killed by SBHA, but its effects on other normal cells need to be tested. Not all melanoma cells were sensitive to SBHA and further study is needed to understand why melanoma lines such as MM200 were resistant to SBHA but very sensitive to other apoptosis-inducing agents such as TRAIL (27, 28).
 |
Footnotes
|
|---|
Grant support: New South Wales State Cancer Council, Melanoma and Skin Cancer Research Institute (Sydney, New South Wales, Australia), and Hunter Melanoma Foundation (Newcastle, New South Wales, Australia).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 10/ 3/03;
revised 1/20/04;
accepted 1/27/04.
 |
References
|
|---|
Csordas A. On the biological role of histone acetylation. Biochem J, 1990;265:23 8.[Medline]
Jenuwein T, Allis CD. Translating the histone code. Science, 2001;293:1074 80.[Abstract/Free Full Text]
Grunstein M. Histone acetylation in chromatin structure and transcription. Nature, 1997;389:349 52.[CrossRef][Medline]
Hassig CA, Schreiber SL. Nuclear histone acetylases and deacetylases and transcriptional regulation: HATs off to HDACs. Curr Opin Chem Biol, 1997;1:300 8.[CrossRef][Medline]
Kouzarides T. Histone acetylases and deacetylases in cell proliferation. Curr Opin Genet Dev, 1999;9:40 8.[CrossRef][Medline]
Van Lint C, Emiliani S, Verdin E. The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation. Gene Expr, 1996;5:245 53.[Medline]
Saito A, Yamashita T, Mariko Y, et al. A synthetic inhibitor of histone deacetylase, MS-27-275, with marked in vivo antitumor activity against human tumors. Proc Natl Acad Sci USA, 1999;96:4592 7.[Abstract/Free Full Text]
Archer SY, Meng S, Shel A, Hodin RA. p21(WAF1) is required for butyrate-mediated growth inhibition of human colon cancer cells. Proc Natl Acad Sci USA, 1998;95:6791 6.[Abstract/Free Full Text]
Sambucetti LC, Fischer DD, Zabludoff S, et al. Histone deacetylase inhibition selectively alters the activity and expression of cell cycle proteins leading to specific chromatin acetylation and antiproliferative effects. J Biol Chem, 1999;274:34940 7.[Abstract/Free Full Text]
Yoshida M, Kijima M, Akita M, Beppu T. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. Biol Chem, 1990;265:17174 9.
Sugita K, Koizumi K, Yoshida H. Morphological reversion of cis-transformed NIH3T3 cells by trichostatin A. Cancer Res, 1992;52:168 72.[Abstract/Free Full Text]
Janson W, Brandner G, Siegel J. Butyrate modulates DNA-damage-induced p53 response by induction of p53-independent differentiation and apoptosis. Oncogene, 1997;15:1395 406.[CrossRef][Medline]
Parsons PG, Hansen C, Fairlie DP, et al. Tumor selectivity and transcriptional activation by azelaic bishydroxamic acid in human melanocytic cells. Biochem Pharmacol, 1997;53:1719 24.[CrossRef][Medline]
Bernhard D, Ausserlechner MJ, Tonko M, et al. Apoptosis induced by the histone deacetylase inhibitor sodium butyrate in human leukemic lymphoblasts. FASEB J, 1999;13:1991 2001.[Abstract/Free Full Text]
Burgess AJ, Pavey S, Warrener R, et al. Up-Regulation of p21 WAF1/CIP1 by histone deacetylase inhibitors reduces their cytotoxicity. Mol Pharmacol, 2001;60:828 37.[Abstract/Free Full Text]
Medina V, Edmonds B, Young GP, James R, Appleton S, Zalewski PD. Induction of caspase-3 protease activity and apoptosis by butyrate and trichostatin A (inhibitors of histone deacetylase): dependence on protein synthesis and synergy with a mitochondrial/cytochrome c-dependent pathway. Cancer Res, 1997;57:3697 707.[Abstract/Free Full Text]
Coffey DC, Kutko MC, Glick RD, et al. The histone deacetylase inhibitor, CBHA, inhibits growth of human neuroblastoma xenografts in vivo, along and synergistically with all-trans retinoic acid. Cancer Res, 2001;61:3591 4.[Abstract/Free Full Text]
Sandor V, Bakke S, Robey RW, et al. Phase I trial of the histone deacetylase inhibitor, depsipeptide (FR901228, NSC 630176), in patients with refractory neoplasms. Clin Cancer Res, 2002;8:718 28.[Abstract/Free Full Text]
Mandel M, Kumar R. Bcl-2 expression regulates sodium butyrate-induced apoptosis in human MCF-7 breast cancer cells. Cell Growth & Differ, 1996;7:311 8.[Abstract]
Hague A, Diaz GD, Hicks DJ, Krajewski S, Reed JC, Paraskeva C. Bcl-2 and bak may play a pivotal role in sodium butyrate-induced apoptosis in colonic epithelial cells; however, overexpression of Bcl-2 does not protect against bak-mediated apoptosis. Int J Cancer, 1997;72:898 905.[CrossRef][Medline]
Cao XX, Mohuiddin I, Ece F, McConkey DJ, Smythe WR. Histone deacetylase inhibitor downregulation of bcl-xl gene expression leads to apoptotic cell death in mesothelioma. Am J Respir Cell Mol Biol, 2001;25:562 8.[Abstract/Free Full Text]
Goh M, Chen F, Paulsen MT, Yeager AM, Dyer ES, Ljungman M. Phenylbutyrate attenuates the expression of Bcl-XL, DNA-PK, Caveolin-1, and VEGF in prostate cancer cells. Neoplasm, 2001;3:331 8.
Bernhard D, Skvortsov S, Tinhofer I, et al. Inhibition of histone deacetylase activity enhances Fas receptor-mediated apoptosis in leukemic lymphoblasts. Cell Death Differ, 2001;8:1014 21.[CrossRef][Medline]
Bonnotte B, Favre N, Reveneau S, et al. Cancer cell sensitization to Fas-mediated apoptosis by sodium butyrate. Cell Growth & Differ, 1998;5:480 7.
Herold K, Rothberg P. Evidence for a labile intermediate in the butyrate induced reduction of the level of c-myc RNA in SW 837 rectal carcinoma cells. Oncogene, 1998;4:423 8.
Kwon SH, Ahn SH, Kim YK, et al. Apicidin, a histone deacetylase inhibitor, induces apoptosis and Fas/Fas ligand expression in human acute promyelocytic leukemia cells. J Biol Chem, 2002;277:2073 82.[Abstract/Free Full Text]
Zhang XD, Franco A, Myers K, Gray C, Nguyen T, Hersey P. Relation of TNF-related apoptosis-inducing ligand (TRAIL) receptor and FLICE inhibitory protein expression to TRAIL-induced apoptosis of melanoma. Cancer Res, 1999;59:2747 53.[Abstract/Free Full Text]
Zhang XD, Zhang XY, Nguyen DT, Gray C, Hersey P. Regulation of TRAIL-induced apoptosis of melanoma by release of Smac/DIABLO from mitochondria. Cancer Res, 2001;61:7339 48.[Abstract/Free Full Text]
Gross A, McDonnell JM, Korsmeyer SJ. Bcl-2 family members and the mitochondria in apoptosis. Genes Dev, 1999;13:1899 911.[Free Full Text]
Gross A, Jockel J, Wei MC, Korsmeyer SJ. Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. EMBO J, 1998;17:3878 85.[CrossRef][Medline]
Nechushtan A, Smith CL, Hsu YT, Youle RJ. Conformation of the Bax C-terminus regulates subcellular location and cell death. EMBO J, 1999;18:2330 41.[CrossRef][Medline]
Hsu YT, Youle RJ. Bax in murine thymus is a soluble monomeric protein that displays differential detergent-induced conformations. J Biol Chem, 1998;273:10777 83.[Abstract/Free Full Text]
Desagher S, Osen-Sand A, Nichols A, et al. Bid-induced conformational change of Bax is responsible for mitochondrial cytochrome c release during apoptosis. J Cell Biol, 1999;144:891 901.[Abstract/Free Full Text]
Puthalakath H, Huang DC, O'Reilly LA, King SM, Strasser A. The proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein motor complex. Mol Cell, 1999;3:287 96.[CrossRef][Medline]
Yamaguchi H, Wang H-G. Bcl-XL protects BimEL-induced Bax conformational change and cytochrome c release independent of interacting with Bax or BimEL. J Biol Chem, 2002;277:41604 12.[Abstract/Free Full Text]
Bouillet P, Purton JF, Godfrey DI, et al. BH3-only Bcl-2 family member Bim is required for apoptosis of autoreactive thymocytes. Nature, 2002;415:922 5.[CrossRef][Medline]
Strasser A, Puthalakath H, Bouillet P, et al. The role of bim, a proapoptotic BH3-only member of the Bcl-2 family in cell-death control. Ann NY Acad Sci, 2000;917:541 8.[Abstract/Free Full Text]
Whitfield J, Neame SJ, Paquet L, Bernard O, Ham J. Dominant-negative c-Jun promotes neuronal survival by reducing BIM expression and inhibiting mitochondrial cytochrome c release. Neuron, 2001;29:629 43.[CrossRef][Medline]
Putcha GV, Moulder KL, Golden JP, et al. Induction of Bim, a proapoptotic BH3-only Bcl-2 family member, is critical for neuronal apoptosis. Neuron, 2001;29:615 28.[CrossRef][Medline]
Brinkmann H, Dahler AL, Popa C, et al. Histone hyperacetylation induced by histone deacetylase inhibitors not sufficient to cause growth inhibition in human dermal fibroblasts. J Biol Chem, 2001;276:22491 9.[Abstract/Free Full Text]
Karpidi E, Cao H, Heltweg B, et al. Hydroxamide derivatives of short-chain fatty acids are potent inducers of human fetal globin gene expression. Exp Hematol, 2003;31:197 203.[CrossRef][Medline]
Puthalakath H, Villunger A, O'Reilly LA, et al. Bmf: a proapoptotic BH3-only protein regulated by interaction with the myosin V actin motor complex, activated by anoikis. Science, 2001;293:1829 32.[Abstract/Free Full Text]
Oda E, Ohki R, Murasawa H, et al. Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science, 2000;288:1053 8.[Abstract/Free Full Text]
Nakano K, Vousden KH. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell, 2001;7:683 94.[CrossRef][Medline]
Cheng EH, Wei MC, Weiler S, et al. BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis. Mol Cell, 2001;8:705 11.[CrossRef][Medline]
Korsmeyer SJ, Gross A, Harada H, et al. Death and survival signals determine active/inactive conformations of pro-apoptotic BAX, BAD, and BID molecules. Cold Spring Harb Symp Quant Biol, 1999;64:343 50.[CrossRef][Medline]
Dijkers PF, Medema RH, Lammers JW, Koenderman L, Coffer PJ. Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr Biol, 2000;10:1201 4.[CrossRef][Medline]
Dijkers PF, Birkenkamp KU, Lam EW, et al. FKHR-L1 can act as a critical effector of cell death induced by cytokine withdrawal: protein kinase B-enhanced cell survival through maintenance of mitochondrial integrity. J Cell Biol, 2002;156:531 42.[Abstract/Free Full Text]
Stahi M, Dijkers PF, Kops GJ, et al. The forkhead transcription factor FoxO regulates transcription of p27kip1 and Bim in response to IL-2. J Immunol, 2002;168:5024 31.[Abstract/Free Full Text]
Ruefli AA, Ausserlechner MJ, Berhard D, et al. The histone deacetylase inhibitor and chemotherapeutic agent suberoylanilide hydroxamic acid (SAHA) induces a cell-death pathway characterized by cleavage of Bid and production of reactive oxygen species. Proc Natl Acad Sci USA, 2001;98:10833 8.[Abstract/Free Full Text]
Glaser KB, Staver MJ, Waring JF, Stender J, Ulrich RG, Davidsen SK. Gene expression profiling of multiple histone deacetylase (HDAC) inhibitors: defining a common gene set produced by HDAC inhibition in T24 and MDA carcinoma cell lines. Mol Cancer Ther, 2003;2:151 63.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
C. C. Jiang, K. Lucas, K. A. Avery-Kiejda, M. Wade, C. E. deBock, R. F. Thorne, J. Allen, P. Hersey, and X. D. Zhang
Up-regulation of Mcl-1 Is Critical for Survival of Human Melanoma Cells upon Endoplasmic Reticulum Stress
Cancer Res.,
August 15, 2008;
68(16):
6708 - 6717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Dai, S. Chen, C. A. Venditti, X.-Y. Pei, T. K. Nguyen, P. Dent, and S. Grant
Vorinostat synergistically potentiates MK-0457 lethality in chronic myelogenous leukemia cells sensitive and resistant to imatinib mesylate
Blood,
August 1, 2008;
112(3):
793 - 804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ning, D. Y. Greenblatt, M. Kunnimalaiyaan, and H. Chen
Suberoyl Bis-Hydroxamic Acid Activates Notch-1 Signaling and Induces Apoptosis in Medullary Thyroid Carcinoma Cells
Oncologist,
February 1, 2008;
13(2):
98 - 104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Liu, A. E. L. Tee, A. Porro, S. A. Smith, T. Dwarte, P. Y. Liu, N. Iraci, E. Sekyere, M. Haber, M. D. Norris, et al.
Activation of tissue transglutaminase transcription by histone deacetylase inhibition as a therapeutic approach for Myc oncogenesis
PNAS,
November 20, 2007;
104(47):
18682 - 18687.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Jiang, L. H. Chen, S. Gillespie, Y. F. Wang, K. A. Kiejda, X. D. Zhang, and P. Hersey
Inhibition of MEK Sensitizes Human Melanoma Cells to Endoplasmic Reticulum Stress-Induced Apoptosis
Cancer Res.,
October 15, 2007;
67(20):
9750 - 9761.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. M. Mhaidat, R. F. Thorne, X. D. Zhang, and P. Hersey
Regulation of Docetaxel-Induced Apoptosis of Human Melanoma Cells by Different Isoforms of Protein Kinase C
Mol. Cancer Res.,
October 1, 2007;
5(10):
1073 - 1081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kato, B. C. Salumbides, X.-F. Wang, D. Z. Qian, S. Williams, Y. Wei, T. B. Sanni, P. Atadja, and R. Pili
Antitumor effect of the histone deacetylase inhibitor LAQ824 in combination with 13-cis-retinoic acid in human malignant melanoma
Mol. Cancer Ther.,
January 1, 2007;
6(1):
70 - 81.
[Abstract]
[Full Text]
[PDF]
|
 |
|