
Mol Cancer Ther. 2004;3:1681-1689
© 2004 American Association for Cancer Research
Diphtheria toxin-murine granulocyte-macrophage colony-stimulating factorinduced hepatotoxicity is mediated by Kupffer cells
Marlena M. Westcott1,
Ralph J. Abi-Habib2,
Kimberley A. Cohen1,
Mark C. Willingham3,
Shihui Liu4,
Thomas H. Bugge5,
Stephen H. Leppla4 and
Arthur E. Frankel1
Departments of 1 Internal Medicine, 2 Biochemistry and 3 Pathology, Wake Forest University School of Medicine, Winston-Salem, North Carolina; 4 Microbial Pathogenesis Section, National Institute of Allergy and Infectious Diseases; and 5 Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH, Bethesda, Maryland
Requests for reprints: Arthur E. Frankel, Wake Forest University School of Medicine, Internal Medicine, Hematology/Oncology, Hanes 5045, Medical Center Boulevard, Winston-Salem, NC 27157. Phone: 336-716-3313; Fax: 336-716-9113. E-mail: afrankel{at}wfubmc.edu
 |
Abstract
|
|---|
DT388GMCSF, a fusion toxin composed of the NH2-terminal region of diphtheria toxin (DT) fused to human granulocyte-macrophage colony-stimulating factor (GMCSF) has shown efficacy in the treatment of acute myeloid leukemia. However, the primary dose-limiting side effect is liver toxicity. We have reproduced liver toxicity in rats using the rodent cell-tropic DT-murine GMCSF (DT390mGMCSF). Serum aspartate aminotransferase and alanine aminotransferase were elevated 15- and 4-fold, respectively, in DT390mGMCSF-treated rats relative to controls. Histologic analysis revealed hepatocyte swelling; however, this did not lead to hepatic necrosis or overt histopathologic changes in the liver. Immunohistochemical staining showed apoptotic cells in the sinusoids, and depletion of cells expressing the monocyte/macrophage markers, ED1 and ED2, indicating that Kupffer cells (KC) are targets of DT390mGMCSF. In contrast, sinusoidal endothelial cells seemed intact. In vitro, DT390mGMCSF was directly cytotoxic to primary KC but not hepatocytes. Two related fusion toxins, DT388GMCSF, which targets the human GMCSF receptor, and DT390mIL-3, which targets the rodent IL-3 receptor, induced a less than 2-fold elevation in serum transaminases and did not deplete KC in vivo. In addition, DTU2mGMCSF, a modified form of DT390mGMCSF with enhanced tumor cell specificity, was not hepatotoxic and was significantly less toxic to KC in vivo and in vitro. These results show that DT390mGMCSF causes liver toxicity by targeting KC, and establish a model for studying how this leads to hepatocyte injury. Furthermore, alternative fusion toxins with potentially reduced hepatotoxicity are presented.
Key Words: diphtheria toxin GMCSF receptor fusion toxin Kupffer cell hepatotoxicity
 |
Introduction
|
|---|
Acute myeloid leukemia (AML) is the most common acute leukemia in adults in the United States. With combination induction and consolidation therapy using cytarabine and topoisomerase II inhibitors, remissions could be achieved (1).However, due in large part to the persistence of leukemic blasts that are resistant to conventional DNA replication-targeted drugs, most patients ultimately relapse and die from the disease or complications of treatment (1).New therapeutics are urgently needed for the treatment of this disease.
Fusion toxins are a novel class of drugs designed to target leukemia cells specifically, by mechanisms other than damaging DNA or blocking cell division. These drugs are chimeras of protein synthesis-inhibiting toxins fused genetically to ligands specific for leukemia blasts (2). One such fusion toxin, DT388GMCSF, is composed of the catalytic and translocation domains of diphtheria toxin (DT) fused to granulocyte-macrophage colony stimulating factor (GMCSF; refs. 3, 4). In vitro, DT388GMCSF was significantly more cytotoxic to GMCSF receptor-positive AML blasts than to normal hematopoietic progenitors (5, 6). DT388GMCSF showed clinical efficacy in producing partial and complete remissions in a phase I trial of patients with relapsed or refractory AML (7). However, liver damage was the predominant side effect that limited dose escalation. Understanding the mechanism of DT388GMCSF-induced liver injury could lead to treatments designed to block liver toxicity while preserving antileukemic efficacy of the drug.
In toxin-sensitive cells, DT388GMCSF binds to and is internalized by GMCSF receptors. Once in endosomes, DT is cleaved by furin, a ubiquitous serine protease (8). The A fragment of DT is then translocated to the cytosol where it catalyzes the ADP-ribosylation of elongation factor-2 (9), resulting in inhibition of protein synthesis and cell death (10). In the study presented here, we have utilized a rodent-tropic homologue of DT388GMCSF, DT390mGMCSF (11), to investigate the mechanism of liver toxicity in a rat model. We have furthermore compared the effects of DT390mGMCSF with two different but related fusion toxins, DT390mIL-3 (12), and DTU2mGMCSF. DT390mIL-3 is a rodent-tropic homologue of DT388IL-3, a chimera of DT and IL-3, which is in early phase I clinical trials for the treatment of AML. Similarly, DTU2mGMCSF is a rodent-tropic homologue of DTU2GMCSF, a modified human GMCSF receptor-targeted fusion toxin. DTU2GMCSF is genetically identical to DT388GMCSF except that the native furin cleavage site in DT has been replaced by a urokinase plasminogen activator (uPA) cleavage site (13). uPA is a secreted serine protease that on cleavage by plasmin, binds to the urokinase plasminogen activator receptor (uPAR). The active uPA/uPAR complex functions in the degradation of extracellular matrix (14). The uPA/uPAR system is overexpressed by many tumors including myeloid leukemias, whereas its expression on normal cells is restricted to certain physiologic processes such as wound healing and tissue remodeling (14, 15). Thus, DTU2GMCSF was designed as a dual specificity fusion toxin to target cells expressing both GMCSF receptor and an active uPA/uPAR system. We have recently reported that AML cell lines are highly sensitive to DTU2GMCSF in vitro (13); however, the in vivo effects of this fusion toxin have not been reported.
In an effort to begin to define the molecular mechanism by which DT388GMCSF leads to liver injury, we sought to establish a model that would allow us to examine the susceptibility of liver cell populations to DT fusion toxins in vivo and in vitro. This report shows that like DT388GMCSF in humans, DT390mGMCSF induces liver injury in Sprague-Dawley rats. Furthermore, using our panel of modified DT-conjugated toxins, we show that the capacity of fusion toxins to damage the liver correlates directly with the susceptibility of Kupffer cells (KC) to their cytotoxic effects.
 |
Materials and Methods
|
|---|
Toxins
The construction, expression, and purification of DT388GMCSF (3), DT390mGMCSF (11), and DT390mIL-3 (12) have been reported previously. To construct DTU2mGMCSF, DTU2GMCSF expression plasmid pRKDTGM-U2 (13) was modified by replacement of the NdeI-EcoRI fragment coding for the human GMCSF with an NdeI-EcoRI fragment that encodes for the mouse GMCSF. The mouse GMCSF coding sequence was amplified by PCR using 5' primer M1 (CCTCATATGGCACCCACCCGCTCACCCATC, the NdeI site is underlined) and 3' primer M2 (CCGAATTCATTTTTGGACTGGTTTTTTGCA, the EcoRI site is underlined). A mouse GMCSF cDNA containing plasmid was used as a template. The resulting PCR product was digested with NdeI and EcoRI, and was then cloned into the NdeI-EcoRI sites of pRKDTGM-U2, yielding DTU2mGMCSF expression plasmid, pRKDTmGM-U2, which was confirmed by DNA sequencing analysis. Ricin was purchased from Sigma-Aldrich (St. Louis, MO) and was stored and handled according to guidelines set by the Wake Forest University School of Medicine Office of Environmental Health and Safety.
Cell Lines
The J774A.1 macrophage cell line was obtained from ATCC and cultured in DMEM supplemented with 10% fetal bovine serum, 2 mmol glutamine, 100 units/mL penicillin, and 100 µg/mL streptomycin. FBL-3 (12, 16) was grown in RPMI medium 1640 supplemented with 10% fetalbovine serum, nonessential amino acids, sodium pyruvate, glutamine, and 10 µg/mL gentamicin. Cells were maintained in their respective growth medium for In Vitro Cytotoxicity Assays.
In vitro Cytotoxicity Assay
To measure cytotoxicity in vitro, tumor cells (1 x 104 per well) were incubated in triplicate in 96-well flat-bottomed dishes with serial dilutions of fusion toxins as indicated. After 48 hours at 37°C, 5% CO2, 1 µCi/well [3H]thymidine was added and the cells were incubated for an additional 18 hours. The cells were then harvested onto glass fiber filters mats using a Skatron cell harvester (Skatron Instruments, Lier, Norway) and the amount of radiolabeled thymidine incorporated into DNA was measured using a Betaplate liquid scintillation counter (Perkin-Elmer, Boston,MA). The percentage of maximal [3H]thymidine incorporation was plotted versus the log of the toxin concentration, and nonlinear regression with a variable slope sigmoidal dose response curve was generated along with the EC50 using GraphPad Prism software. The EC50 was defined as the concentration of toxin that inhibited [3H]thymidine incorporation by 50% as compared with control cells incubated in medium without toxin. Cytotoxicity assays were done at least thrice for each tumor cell line and representative experiments are shown.
In vitro Toxicity Studies
Female Sprague-Dawley rats (Harlan, Indianapolis, IN) weighing 250 to 300 g were used for all experiments. Rats were treated with 200 µg/kg fusion toxins. Animals were sacrificed after 12 to 18 hours by CO2 inhalation and blood was collected from the inferior vena cava. Serum was analyzed for the presence of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) by the clinical chemistry laboratory at Wake Forest University Medical Center. For histologic and immunostaining procedures, liver samples were fixed in 10% neutral buffered formalin and embedded in paraffin or snap-frozen in Tissue Tek optimum cutting temperature compound and stored at 80°C prior to preparing sections. For histopathologic evaluation, liver sections representative of each group of rats were stained with H&E. For transaminase data, statistical significance was analyzed by one-way ANOVA. In vivo experiments were done at least twice for each fusion toxin, and representative experiments are shown.
Electron Microscopy
Liver samples obtained from control and toxin-treated rats were fixed in 2.5% glutaraldehyde and processed by the electron microscopy laboratory at Wake Forest University School of Medicine using standard methods. Toluidine bluestained, plastic-embedded thick sections were examined and photographed under light microscopy. Representative areas were further processed for thin sections and examination by transmission electron microscopy.
Immunohistochemistry to Detect Apoptotic Cells
Formalin-fixed paraffin sections were deparaffinized and incubated at 95°C for 1 hour in antigen unmasking solution (Vector Laboratories, Burlingame, CA) followed by a 20-minute cool-down at room temperature. All subsequent steps were done at room temperature. To block endogenous peroxidase, slides were incubated for 10 minutes in 0.3% H2O2. After washing thrice with water and thrice with PBS, the sections were blocked for 10 minutes with 10% normal goat serum in PBS. Blocker was drawn off with a pipette and replaced with rabbit anticleaved caspase 3 (Cell Signaling Technologies, Beverly, MA) diluted 1:100 in PBS + 1% normal goat serum. After 1 hour, slides were washed thrice with PBS and treated with goat anti-rabbit IgG-horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA; 1:250 in PBS + 1% normal goat serum) for 30 minutes. Slides were then washed and treated with NovaRED substrate (Vector Laboratories) according to the manufacturers instructions, lightly counterstained with hematoxylin, dehydrated, and mounted with Permount (Fisher Scientific, Fair Lawn, NJ).
Immunofluorescence Staining to Detect Kupffer Cells
Cryosections prepared from snap-frozen liver tissue blocks were fixed for 5 minutes in room temperature acetone and washed with PBS. All subsequent steps were done at room temperature with four PBS washes after each step. Sections were treated with 10% normal goat serum in PBS for 10 minutes and then with antibodies diluted in PBS + 1% normal goat serum as follows: mouse anti-rat ED2 (2.5 µg/mL; Serotec, Raleigh, NC) or mouse IgG control (Zymed, South San Francisco, CA) for 1 hour, followed by TRITC-conjugated F(ab')2 fragment of goat anti-mouse IgG (1:200; Jackson ImmunoResearch) for 30 minutes. Sections were then blocked for 10 minutes with PBS + 10% normal mouse serum and treated with mouse anti-rat ED1-FITC (2.5 µg/mL in PBS + 1% normal mouse serum; Serotec) or mouse IgG-FITC control (Jackson ImmunoResearch) for 30 minutes. After washing, sections were fixed with 10% neutral-buffered formalin and mounted with Vectashield (Vector Laboratories).
Isolation and Culture of Primary Rat Liver Cells
Primary hepatocytes and nonparenchymal cells (NPC) were obtained by perfusing the livers of sodium pentobarbital-anesthetized rats with a solution of 0.05% collagenase IV (Worthington Biochemical Corp., Lakewood, NJ) according to the two-step method of Seglen (17). Dissociation of the liver tissue, preparation of a single-cell suspension and subsequent purification steps were done at 4°C. Viability of the initial suspension ranged from 70% to 85%. Hepatocytes were separated from NPC by centrifugation at 50 x g for 2.5 minutes and further purified by centrifugation on 60% Percoll gradients as detailed by Smedsrod and Pertoft (18). The NPC fraction, retained in the supernatant of the initial differential centrifugation step, was further purified by centrifugation on a two-step Percoll gradient consisting of 60% and 25% layers (18). After centrifugation at 400 x g for 20 minutes, cells at the interface of the two layers, consisting of viable NPC, were collected. Hepatocytes were washed, resuspended in hepatocyte culture medium (Biowhittaker, Walkersville, MD) and seeded at 2.5 x 104 per well in 96-well dishes coated with type I rat tail collagen (Sigma-Aldrich). After 2 hours at 37°C, 5% CO2, the wells were gently washed once and fresh medium was added. Cells were rested for 24 hours prior to assays. NPC were washed and seeded in 96-well dishes at 5 x 104 per well in Williams' medium E supplemented with 10% fetal bovine serum, glutamine and penicillin-streptomycin. After overnight incubation, medium was gently aspirated and fresh medium was added in preparation for the cytotoxicity assay. Alternatively, NPC were seeded at 3 x 106 per 35 mm dish and incubated for 3 hours at 37°C, 5% CO2. Dishes were washed thrice to remove nonadherent cells, and fresh medium was added. After an overnight incubation, the cells were rinsed and treated with 0.05% trypsin in serum-free medium for 30 minutes at 37°C to further enrich for KC, which are resistant to light trypsin treatment (19). After the addition of fresh medium, cells were cultured overnight. The remaining cells had typical KC morphology and phagocytosed 1 µmol/L fluorescent latex beads.
Primary Cell Cytotoxicity Assays
Ninety-six well cytotoxicity assays were done as per the protocol for tumor cells except that after 24 hours, [3H]leucine (L-leucine [3,4,5-3H]; MP Biomed, Inc., Irvine, CA) was added in leucine-free Williams' medium E containing 5% dialyzed fetal bovine serum (Life Technologies, St. Paul, MN), and the cultures were incubated for an additional 18 hours. Plates were subject to one cycle of freezing and thawing to detach adherent cells prior to harvesting onto filter mats. Results are expressed as cpm ± SD of [3H]leucine incorporated by triplicate wells of cells at the indicated doses of fusion toxin, and are representative of at least two experiments for each cell type. For qualitative analysis, experiments were run in parallel with KC isolated and cultured in 35 mm dishes as described above. Cells were incubated with 1 nmol/L fusion toxins, and after 24 hours, monolayers were fixed, stained with 4',6-diamidino-2-phenylindole and evaluated for cytopathic effects by light and fluorescence microscopy.
Immunofluorescence to Detect Sinusoidal Endothelial Cells
Cryosections were stained for sinusoidal endothelial cells (SEC) using the method described for KC except that the primary antibody was monoclonal anti-rat hepatic sinusoidal endothelial cells, SE-1, 5 µg/mL (KMI Diagnostics/IBL America, Minneapolis, MN; ref. 20), followed by rhodamine-conjugated secondary antibody as above.
 |
Results
|
|---|
In vitro Cytotoxicity of Fusion Toxins
For the in vivo studies presented in this report, we utilized four different DT fusion proteins: DT388GMCSF, DT390mGMCSF, DTU2mGMCSF, and DT390mIL-3. As shown in Fig. 1, all fusion proteins were highly cytotoxic in vitro for tumor cells expressing their respective target receptors. The EC50 for each fusion toxin was as follows: DT390mGMCSF, 13 pmol; DTU2mGMCSF, 6 pmol; DT390mIL-3, 14 pmol. Note that due to minimal cross-reactivity with the rodent GMCSF receptor, DT388GMCSF did not kill the mouse tumor cell line J774A.1. The EC50 of DT388GMCSF for TF1vSrc human AML cells is approximately 1.0 pmol (13).
In vitro Toxicity: Serum Chemistry
Rats were treated with 200 µg/kg fusion toxins and hepatic transaminase levels were measured in serum 16 hours later. As shown in Fig. 2, DT390mGMCSF treatment induced a significant increase in serum AST and ALT levels, approximately 15-fold (P < 0.01) and 4-fold (P < 0.01), respectively, relative to saline-treated controls. In addition, AST and ALT levels were significantly higher in DT390mGMCSF treated rats as compared with DTU2 mGMCSF, DT390mIL-3, and DT388GMCSF-treated rats (P < 0.01). Small increases in transaminase levels relative to saline-treated controls were observed for DT390mIL-3, DTU2mGMCSF, and DT388GMCSF, but these increases were not statistically significant. Other serum chemistries were normal in DT390mGMCSF-treated rats with the exception of alkaline phosphatase and lactate dehydrogenase, which were elevated an average of 2- and 25-fold, respectively, relative to controls (data not shown). Peripheral blood cell counts were within reference range in DT390mGMCSF-treated rats (data not shown). Therefore, DT390mGMCSF caused liver injury in rats similar to that which is observed with DT388GMCSF in humans. In addition, these results show that hepatotoxicity is GMCSF receptormediated.

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. Rats were treated with 200 µ_0;g/kg DT390mGMCSF, DT388GMCSF, DT390mIL-3, DTU2mGMCSF, or saline. Serum was collected after 16 hours and analyzed for levels of AST (A) and ALT (B). Results are expressed as the mean±SD of AST or ALT (international units per liter) in serum. Saline (n = 12), DT390mGMCSF (n = 14), DT390mIL-3 (n = 8), DTU2mGMCSF (n = 8), and DT388GMCSF (n = 4).
|
|
In vitro Toxicity: Liver Histology
Elevated serum transaminase levels did not reflect overt pathologic changes in the livers of DT390mGMCSF-treated rats as assessed by H&E staining of formalin-fixed, paraffin-embedded tissue. Figure 3B depicts liver tissue sampled from a DT390mGMCSF-treated rat that had a serum ALT level of 490 IU/L, as compared with that of the saline-treated control in Fig. 3A, which had an ALT level of 45 IU/L. There was no evidence for hepatocyte death or inflammatory infiltrate and liver architecture remained largely intact. However, light microscopy analysis of hepatic tissue embedded for electron microscopy revealed a heterogeneous pattern on staining with toluidine blue, suggestive of hepatocyte swelling in DT390mGMCSF-treated livers (Fig. 3D and inset). This pattern was not detected in saline-treated control livers (Fig. 3C). Ultrastructural analysis confirmed that swollen hepatocytes were interspersed among hepatocytes with normal morphology in livers from treated but not control rats (Fig. 4A and B). In no case did we find evidence, at the light or ultrastructural level, for hepatocyte apoptosis or necrosis. Therefore, DT390mGMCSF treatment causes hepatocellular swelling, which likely explains hepatic enzyme elevations observed in the serum of treated rats.

View larger version (141K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. Rats were treated with saline (A, C) or with 200 µg/kg DT390mGMCSF (B, D). Livers were harvested 12 to 18 hours later for histologic analysis. A and B, formalin-fixed, paraffin-embedded tissue stained with H&E; magnification (x 170). C and D, glutaraldehyde-fixed, plastic-embedded tissue stained with toluidine blue. Short arrow, lightly stained hepatocytes; long arrow, darkly stained hepatocytes; magnification (x 130). Inset, high-magnification image (x 315) in grayscale to highlight the heterogeneous staining pattern in DT390mGMCSF-treated liver.
|
|

View larger version (115K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. Rats were treated with saline (A) or 200 µg/kg DT390mGMCSF (B). Livers were harvested, fixed and processed for electron microscopy 18 hours later. Short arrow, swollen hepatocyte; long arrow, hepatocyte with normal morphology; magnification (x 1,200).
|
|
Immunohistochemical Staining for Apoptotic Cells in the Liver
DT388GMCSF has been shown to induce death by apoptosis in susceptible cells (10, 21). In order to evaluate DT390mGMCSF-treated livers more closely for the presence of apoptotic cells, we stained liver sections with an antibody specific for the activated form of caspase-3 (22). As shown in Fig. 5, apoptotic cells (stained red) were detected in the sinusoidal spaces of DT390mGMCSF-treated but not saline-treated rats. In contrast, parenchymal cells did not exhibit specific staining with this antibody. These results indicate that sinusoidal cells, not hepatocytes, are direct targets of DT390mGMCSF.

View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 5. Rats were treated with saline (A) or 200 µg/kg DT390mGMCSF (B) for 12 hours. Livers were harvested and sections were prepared and stained with rabbit anti-activated caspase-3 followed by goat anti-rabbit IgG-horseradish peroxidase. Caspase-3-positive cells were visualized using the chromogenic horseradish peroxidase substrate, NovaRED. Controls treated with rabbit IgG in place of the first antibody showed no positive staining (data not shown); magnification (x 265).
|
|
Immunofluorescence Staining for ED1-Positive and ED2-Positive Cells in the Liver
DT388GMCSF was designed to target GMCSF receptor-positive leukemic blasts. We have shown that DT390mGMCSF-induced liver toxicity requires specific interaction with GMCSF receptor-positive cells and that sinusoidal cells in the livers of treated rats die by apoptosis. Therefore, we examined the livers of DT390mGMCSF-treated rats for the presence of KC, resident liver macrophages that are located in the sinusoidal spaces. The monoclonal antibody ED1 recognizes a lysosomal membrane protein expressed by all subsets of rat monocytes and macrophages, whereas ED2 expression is restricted to resident tissue macrophages, including KC (23). As shown in Fig. 6, ED1-positive and ED2-positive cells were virtually depleted in the livers of DT390mGMCSF-treated rats. DT390mGMCSF-treated livers displayed a punctate staining pattern, likely reflecting remnants of dead KC. Intact ED1-positive and ED2-positive cells were rarely observed. In contrast, ED1-positive and ED2-positive cells were detected in the livers of DT390mIL-3 and DTU2mGMCSF-treated rats. Therefore, DT390mGMCSF targets and depletes KC in the rat model. In contrast, DT390mIL-3 and DTU2mGMCSF do not effectively target KC in vivo.

View larger version (9K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 6. Rats were treated with saline (A), DT390mGMCSF (B), DT390mIL-3 (C), or DTU2mGMCSF (D). Livers were harvested 16 hours later and snap-frozen in optimum cutting temperature embedding compound. Cryosections were prepared and stained with monoclonal anti-rat ED2 followed by goat anti-mouse IgG-rhodamine or anti-rat ED1 directly conjugated to FITC. Controls treated with mouse IgG in place of the first antibody showed no specific staining (data not shown); magnification (x 230).
|
|
Susceptibility of Primary Liver Cells to DT390GMCSF In vitro
To confirm that DT390mGMCSF is directly cytotoxic for KC but not hepatocytes, and to establish an in vitro system for further study, we isolated primary hepatocytes and KC-enriched NPC from normal rats and cultured the cells in the presence of fusion toxins. Ricin, included as a positive control, killed primary hepatocytes in a dose-dependent manner, whereas DT390mGMCSF had no effect on hepatocytes (Fig. 7A). Similar results were obtained with primary rat hepatocytes obtained from a commercial source (Biowhittaker) and with the rat hepatoma McA-RH7777 (data not shown).
In contrast to the insensitivity of hepatocytes to its cytotoxic effects, DT390mGMCSF inhibited the incorporation of [
3H]leucine in the KC-containing NPC fraction in a dose-dependent manner (Fig. 7B). In addition, DTU2mGMCSF was significantly less cytotoxic for the KC-containing NPC fraction than DT390mGMCSF (EC50: 13 nmol/L, DTU2GMCSF; 4.4 pmol, DT390GMCSF; Fig. 7B).
KC that were further purified from the NPC fraction by adherence and light trypsin treatment to remove contaminating SEC were killed after 18 hours of culture with 1 nmol/L DT390mGMCSF (Fig. 8C). KC that were treated with the same dose of DT388GMCSF (Fig. 8B) were intact, similar to controls incubated without toxins (Fig. 8A). 4',6-Diamidino-2-phenylindolestaining revealed nuclei with apoptotic morphology in DT390mGMCSF-treated cells (Fig. 8E, G). These results are consistent with our in vivo data demonstrating that DT390GMCSF is directly cytotoxic for KC. Furthermore, our results indicate that the modified fusion toxin, DTU2mGMCSF, is not hepatotoxic because it does not effectively target KC.

View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 8. Phase contrast photomicrographs of KCs purified from the NPC fraction by adherence as described in Materials and Methods, and cultured for 18 hours in medium without toxin (A), medium containing 1 nmol/L DT388GMCSF (B), or medium containing 1 nmol/L DT390mGMCSF (C); magnification (x 125). Phase contrast and corresponding 4',6-diamidino-2-phenylindolestained images of cells treated with saline (D, E) or DT390mGMCSF (F, G) as described for A and B; magnification (x 250).
|
|
Immunofluorescence Staining for Sinusoidal Endothelial Cells
Having established that KC but not hepatocytes are directly killed by DT390mGMCSF, we addressed the possibility that DT390GMCSF targets the third major liver cell population, the SEC. Fresh-frozen liver samples were stained with monoclonal antibody SE-1 which is specific for rat hepatic SEC (20). No difference in staining pattern or intensity was observed between saline-treated controls and DT390mGMCSF-treated livers (Fig. 9). As reported previously for this antibody, SECs (short arrow), but not endothelium lining the large vessels (long arrow), stained positive for SE-1 (20). Although this analysis does not rule out functional effects on SEC, it indicates that unlike KC, SEC remain intact in DT390mGMCSF-treated livers.

View larger version (162K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 9. Rats were treated i.p. with saline (A, B) or 200 µg/kg DT390mGMCSF (C, D). Livers were harvested after 16 hours and snap-frozen in optimum cutting temperature embedding compound. Cryosections were prepared and stained with monoclonal anti-rat hepatic SECs (SE-1) followed by rhodamine-conjugated goat anti-mouse IgG. Phase contrast images (A, C) are shown for each fluorescent field (B, D) to highlight tissue architecture. Short arrows, endothelial cells lining the sinusoids but not the large vessels; long arrows, stain with SE-1. Magnification (x 170).
|
|
 |
Discussion
|
|---|
There are currently few therapeutic alternatives for the treatment of relapsed or refractory AML. Ongoing phase I clinical trials with DT388GMCSF have shown antileukemic efficacy, but the use of the drug is limited by its hepatotoxic effects. Defining the mechanism of hepatotoxicity would aid in the rational design of new fusion toxins and could lead to the development of therapies to block the undesirable effects on the liver. To this end, we developed a rat model using the rodent-tropic fusion toxin DT390mGMCSF, and two related DT-conjugated fusion toxins, DT390mIL-3 and DTU2mGMCSF. Similar to the effects of DT388GMCSF in humans, DT390mGMCSF induced significant serum AST and ALT elevations in Sprague-Dawley rats. This model allowed us to study the effect of DT-conjugated fusion toxins on rat liver cell populations in vivo and in vitro.
Using the rat model, our initial in vivo observation was that despite 4- to 15-fold elevations in ALT and AST, respectively, livers from treated animals were histologically unremarkable as assessed by H&E staining (Fig. 3). There was no evidence for hepatocyte apoptosis/necrosis or inflammation, even when we employed a dosing regimen in which the toxin was given daily over a period of several days (data not shown). This is in marked contrast to other hepatotoxic agents, such as CCL4 and acetaminophen, which induce large-scale hepatocyte necrosis accompanied by up to 100-fold elevations in serum transaminases (24, 25).The relatively moderate transaminase elevations induced by DT390mGMCSF are likely due to the release of cytoplasmic contents from swollen hepatocytes, which were revealed when tissues were fixed and processed for ultrastructural analysis. We hypothesize that in the rat model, hepatocellular swelling does not progress to overt liver damage because of the well-documented ability of hepatocytes to recover from this type of injury. For example, hepatocellular swelling can be induced experimentally in rats by the presence of excess glutamine, an effect which is fully reversible (26). Indeed, in most cases, transaminemia observed in human patients treated with DT388GMCSF is transient (7) suggesting that hepatocytes recover. In some cases, DT388GMCSF-mediated hepatotoxic effects may be amplified by factors related to AML and prior chemotherapy, leading to liver failure.
Consistent with the lack of in vivo evidence for hepatocyte apoptosis/necrosis, we have shown that primary rat hepatocytes (Fig. 7) and a rat hepatocyte cell line (data not shown) are not killed by DT390mGMCSF in vitro. These results corroborate our published data demonstrating that DT388GMCSF does not kill the human hepatocyte cell line, HepG2 (7). Therefore DT390mGMCSF seems to induce liver injury via an indirect rather than a direct effect on hepatocytes.
In contrast to the insensitivity of hepatocytes to DT390mGMCSF, we have provided multiple lines of evidence that DT390mGMCSF targets GMCSF receptorpositive liver macrophages (KC). ED1-positive and ED2-positive KC were depleted in the livers of treated rats, and apoptotic cells were detected in the sinusoids. In addition, primary KC isolated from normal rats were killed by DT390mGMCSF in vitro. Unlike KC, our data indicate that SEC do not seem to be directly targeted by DT390mGMCSF in vivo.
We have shown that KC are targeted by DT390mGMCSF and further, that hepatotoxicity is a direct result of the targeting of GMCSF receptor-positive cells, rather than a nonspecific effect mediated by the DT portion of the molecule. Treatment of rats with DT390mIL-3, which targets the rodent IL-3 receptor, or DT388GMCSF, which does not cross-react with the rat GMCSF receptor, did not induce transaminase elevations of a magnitude comparable that of DT390mGMCSF. A direct relationship between DT390mGMCSF-induced KC death and liver injury was further substantiated by treating rats with the modified fusion toxin,DTU2mGMCSF. In marked contrast to DT390mGMCSF, treatment of rats with DTU2mGMCSF did not damage the liver as reflected by serum transaminases, and did not deplete KC in vivo. Furthermore, DTU2mGMCSF was significantly less effective at killing primary KC
in vitro than was DT390mGMCSF. Although not formally addressed in this study, these results suggest that KC have insufficient levels of cell surface urokinase activity to confer susceptibility to DTU2mGMCSF. A more detailed analysis of the interaction of DTU2mGMCSF with KC will be a subject of future studies.
The current report does not address the molecular mechanism by which KC death leads to hepatocyte injury. However, our analysis suggests that hepatocytes in treated animals suffer membrane damage that alters the ionic balance and causes swelling, which likely accounts for the release of hepatic transaminases into serum. This effect could be mediated by the local release of hepatotoxic factors from dying KC. Indeed, we have evidence for the presence of nitrotyrosine-modified proteins in the livers of treated rats, suggesting that superoxide and nitric oxide might be involved in the toxicity mechanism.6 Alternatively,as has been reported for acetaminophen hepatotoxicity (27), the loss of KC may deplete a hepatoprotective cytokine such as IL-10 or IL-6, or a cyclooxygenase-derived prostanoid. These two possibilities are not mutually exclusive. Current studies are focused on in vivo and in vitro approaches using the rat model to address these issues.
Others have reported liver toxicity associated with high doses of DTmGMCSF in leukemic Brown Norway rats but the mechanism of liver injury was not addressed in the study (28). We have reported a Sprague-Dawley model of DT388GMCSF-induced liver damage that has revealed a critical role for KC in this process, and which should allow us to determine how the targeting of KC leads to hepatocyte injury. Once this mechanism is understood, the Brown Norway model can be used to address the effect of leukemia on drug-induced hepatotoxicity. The importance of understanding the relationship between KC injury and liver damage extends to other immunotoxins, for example, anti-CD33 calichaemicin (Mylotarg). This drug, also used in the treatment of AML, induces liver damage by an unknown mechanism that may be related to its targeting of CD33-positive liver macrophages (29).
In conclusion, the data presented in the current report have significantly advanced our understanding of DT388GMCSF-mediated liver damage. In addition, we have described two fusion toxins that do not have significant hepatotoxic effects in rats, and may therefore prove to be safer alternatives for the treatment of AML. Indeed, DT388IL-3, the human equivalent of DT390mIL-3 showed little to no toxicity in preclinical dose-escalation studies (30) and its antileukemic efficacy is currently being evaluated in phase I clinical trials. DTU2mGMCSF, unlike DT390mGMCSF, did not induce liver injury in rats due to its inefficient targeting of KC. Thus, a single substitution designed to enhance tumor cell specificity virtually eliminated hepatotoxicity in vivo. These results, along with our recent report describing the in vitro antitumor activity of DTU2GMCSF (13) provide initial validation for the dual specificity approach to the design of fusion toxins. Current studies are focused on confirming in vivo safety and evaluating the antileukemic efficacy of DTU2mGMCSF in a murine leukemia model. Further characterization of DTU2mGMCSF, combined with a more detailed analysis of the mechanism of DT390mGMCSF-induced liver toxicity, should lead to significant advances in the treatment of relapsed and refractory AML.
 |
Footnotes
|
|---|
Grant support: NIH grants RO1CA76178 and RO1CA90263(A.E. Frankel).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
6 Westcott and Frankel, unpublished data. 
Received 6/30/04;
revised 8/18/04;
accepted 8/27/04.
 |
References
|
|---|
Bennett JM, Kouides PA, Forman SJ. The myelodysplastic syndromes: morphology, risk assessment, and clinical management. Int J Hematol 2002;76:22838.
Frankel AE, Powell BL, Vallera DA, Neville DA. Chimeric fusion proteins (diphtheria toxin-based). Curr Opin Investig Drugs 2001;2:1294301.[Medline]
Frankel AE, Ramage J, Latimer A, et al. High-level expression and purification of the recombinant diphtheria fusion toxin DTGM for PHASE I clinical trials. Protein Expr Purif 1999;16:190201.[CrossRef][Medline]
Perentesis JP, Bendel AE, Shao Y, et al. Granulocyte-macrophage colony-stimulating factor receptor-targeted therapy of chemotherapy- and radiation-resistant human myeloid leukemias. Leuk Lymphoma 1997;25:24756.[Medline]
Hall PD, Willingham MC, Kreitman RJ, Frankel AE. DT388-GM-CSF, a novel fusion toxin consisting of a truncated diphtheria toxin fused to human granulocyte-macrophage colony-stimulating factor, prolongs host survival in a SCID mouse model of acute myeloid leukemia. Leukemia 1999;13:62933.[CrossRef][Medline]
Hogge DE, Willman CL, Kreitman RJ, et al. Malignant progenitors from patients with acute myelogenous leukemia are sensitive to a diphtheria toxin granulocyte-macrophage colony-stimulating factor fusion protein. Blood 1998;92:58995.[Abstract/Free Full Text]
Frankel AE, Powell BL, Hall PD, Case LD, Kreitman RJ. Phase I trial of a novel diphtheria toxin/granulocyte macrophage colony-stimulating factor fusion protein (DT388GMCSF) for refractory or relapsed acute myeloid leukemia. Clin Cancer Res 2002;8:100413.[Abstract/Free Full Text]
Gordon V, Klimpel K, Arora N, Henderson M, Leppla S. Proteolytic activation of bacterial toxins by eukaryotic cells is performed by furin and by additional cellular proteases. Infect Immun 1995;63:827.[Abstract]
Van Ness BG, Howard JB, Bodley JW. ADP-ribosylation of elongation factor 2 by diphtheria toxin: isolation and properties of the novel ribosyl-amino acid and its hydrolysis products. J Biol Chem 1980;255:1071720.[Abstract/Free Full Text]
Kochi SK, Collier RJ. DNA fragmentation and cytolysis in U937 cells treated with diphtheria toxin or other inhibitors of protein synthesis. Exp Cell Res 1993;208:296302.[CrossRef][Medline]
Chan C, Blazar BR, Eide CR, Kreitman RJ, Vallera DA. a murine cytokine fusion toxin specifically targeting the murine granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor on normal committed bone marrow progenitor cells and GM-CSF-dependent tumor cells. Blood 1995;86:273240.[Abstract/Free Full Text]
Vallera DA, Jin N, Shu Y, Panoskaltsis-Mortari A, Kelekar A, Chen W. Retroviral immunotoxin gene therapy of leukemia in mice using leukemia-specific T cells transduced with an interleukin-3/Bax fusion protein gene. Hum Gene Ther 2003;14:178798.[CrossRef][Medline]
Abi-Habib RJ, Liu, S, Bugge TH, Leppla S, Frankel AE. A urokinase activated recombinant diphtheria toxin targeting the granulocyte-macrophage colony-stimulating factor receptor is selectively cytotoxic to human acute myeloid leukemia blasts. Blood 2004;104:21438.[Abstract/Free Full Text]
Dano K, Romer J, Nielsen BS, et al. Cancer invasion and tissue remodeling-cooperation of protease systems and cell types. APMIS 1999;107:1207.[Medline]
Ramage J, Vallera DA, Black JH, Aplan PD, Kees UR, Frankel AE. The diphtheria toxin/urokinase fusion protein (DTAT) is selectively toxic to CD87 expressing leukemic cells. Leuk Res 2003;27:7984.[CrossRef][Medline]
Cheever MA, Chen W. Therapy with cultured T cells: principles revisited. Immunol Rev 1997;157:17794.[CrossRef][Medline]
Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol 1976;13:2983.[Medline]
Smedsrod B, Pertoft H. Preparation of pure hepatocytes and reticuloendothelial cells in high yield from a single rat liver by means of percoll centrifugation and selective adherence. J Leuk Biol 1985;38:21330.[Abstract]
Paul P, Rothmann SA, McMahon JT, Gordon AS. Erythropoietin secretion by isolated rat Kupffer cells. Exp Hematol 1984;12:82530.[Medline]
Ohmura T, Enomoto K, Hitoshi S, Sawada N, Mori M. Establishment of a novel monoclonal antibody, SE-1, which specifically reacts with rat hepatic sinusoidal endothelial cells. J Histochem Cytochem 1993;41:12537.[Abstract]
Thorburn J, Frankel AE, Thornburn A. Apoptosis by leukemia cell-targeted diphtheria toxin occurs via receptor-independent activation of Fas-associated death domain protein. Clin Cancer Res 2003;9:8615.[Abstract/Free Full Text]
Gown AM, Willingham MC. Improved detection of apoptotic cells in archival paraffin sections: immunohistochemistry using antibodies to cleaved caspase 3. J Histochem Cytochem 2002;50:44954.[Abstract/Free Full Text]
Dijkstra CD, Dopp EA, Joling P, Kraal G. The heterogeneity of mononuclear phagocytes in lymphoid organs: distinct macrophage subpopulations in the rat recognized by monoclonal antibodies ED1, ED2 and ED3. Immunology 1985;54:58999.[Medline]
Bessems JG, Vermeulen NP. Paracetamol (acetaminophen)-induced toxicity: molecular and biochemical mechanisms, analogues and protective approaches. Crit Rev Toxicol 2001;31:55138.[CrossRef][Medline]
Plaa GL, Charbonneau M. Detection and evaluation of chemically induced liver injury. In: Hayes AW, editor. Principles and methods of toxicology. 4th ed. Philadelphia: Taylor & Francis; 2001. p. 114587.
Haussinger D, Hallbrucker C, vom Dahl S, Lang F, Gerok W. Cell swelling inhibits proteolysis in perfused rat liver. Biochem J 1990;272:23942.[Medline]
Ju C, Reilly TP, Bourdi M, et al. Protective role of Kupffer cells in acetaminophen-induced hepatic injury in mice. Chem Res Toxicol 2002;15:150413.[CrossRef][Medline]
Rozemuller H, Rombouts E, Touw IP, et al. In vivo targeting of leukemic cells using diphtheria toxin fused to murine GM-CSF. Leukemia 1998;12:7107.[CrossRef][Medline]
Rajvanshi P, Shulman HM, Sievers EL, McDonald GB. Hepatic sinusoidal obstruction after gemtuzumab ozogamicin (Mylotarg) therapy. Blood 2002;99:23104.[Abstract/Free Full Text]
Cohen KA, Liu TF, Cline JM, Wagner JD, Hall PD, Frankel AE. Toxicology and pharmacokinetics of DT388IL3, a fusion toxin consisting of truncated diphtheria toxin (DT388) linked to human interleukin 3 (IL3), in cynomolgus monkeys. Leuk Lymphoma 2004;45:164756.[CrossRef][Medline]