Molecular Cancer Therapeutics CTRC-AACR San Antonio Breast Cancer Symposium Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Y.
Right arrow Articles by Rosenblum, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Y.
Right arrow Articles by Rosenblum, M. G.
Mol Cancer Ther. 2003;2:1341-1350
© 2003 American Association for Cancer Research

Targeted delivery of human pro-apoptotic enzymes to tumor cells: In vitro studies describing a novel class of recombinant highly cytotoxic agents

Yuying Liu1, Lawrence H. Cheung1, Walter N. Hittelman2 and Michael G. Rosenblum1

1 Immunopharmacology and Targeted Therapy Section, Department of Bioimmunotherapy and 2 Department of Experimental Therapeutics, M. D. Anderson Cancer Center, Houston, TX

Requests for Reprints: Michael G. Rosenblum, Immunopharmacology and Targeted Therapy Section, Department of Bioimmunotherapy, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Unit 44, Houston, TX 77030. Phone: (713) 792-3554; Fax: (713) 794-4261. E-mail: mrosenbl{at}notes.mdacc.tmc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 In Vitro Cytotoxic Effects...
 Discussion
 References
 
The serine protease granzyme B (GrB, 25 kDa) can initiate apoptosis by multiple mechanisms including directly activating caspases, inducing DNA fragmentation, activating the mitochondrial death pathway, and directly cleaving the nuclear matrix. The purpose of this study was to determine whether a recombinant antibody could deliver sufficient amounts of GrB to target cells to generate an apoptotic signal. The gene sequence encoding GrB was attached to the single-chain anti-melanoma antibody scFvMEL (anti-gp240) via a flexible (G4S) tether. The 53-kDa GrB/scFvMEL fusion protein was expressed in bacteria and purified by metal affinity chromatography. Western blotting confirmed presence of both scFvMEL and GrB proteins. The fusion construct displayed intact GrB enzymatic activity (specific activity = 2.6 x 105 units/µmol) similar to native GrB (specific activity = 4.8 x 105 units/µmol). The construct bound specifically to human A375-M melanoma cells and delivered GrB to the cytosol as assessed by confocal microscopy. Against log-phase melanoma cells, GrB/scFvMEL demonstrated an IC50 of 20 nM and minimal cytotoxicity to non-target cells at doses of up to 1 µM. Coadministration of exogenous perforin (PFN) to cells resulted in a slight increase in the cytotoxic effects of the GrB/scFvMEL construct on A375 target cells and a significant increase in cytotoxicity to SKBR3 (non-target) cells. The cytotoxic effects of this fusion construct on target cells were similar to those of the previously described MEL sFv/rGel fusion toxin (IC50 ~20 nM). The construct produced impressive apoptotic effects by 8 h after treatment of target cells. Mediation of the apoptotic effects of GrB/scFvMEL included caspase-3 cleavage and release of cytochrome c into the cytosolic compartment from the mitochondrial compartment. These studies demonstrate that delivery of the human pro-apoptotic pathway enzyme GrB to tumor cells may have significant therapeutic potential for cancer treatment and represents a new class of targeted therapeutic agents with a defined mechanism of action.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 In Vitro Cytotoxic Effects...
 Discussion
 References
 
The serine protease granzyme B (GrB) (1, 2) is integrally involved in apoptotic cell death induced in target cells on their exposure to CTLs and natural killer (NK) cells (3, 4). Cytotoxic lymphocyte granules contain perforin (PFN), a pore-forming protein, and a family of serine proteases termed granzymes. In CTL-mediated cytolysis, PFN is initially released and it inserts into the target cell membranes where it polymerizes to form transmembrane pores (5, 6), which facilitates access of natural killer or CTL-released GrB to the target cell cytoplasm. Alternatively, other authors have suggested that after release from CTLs, GrB may be internalized into target cells by receptor-mediated endocytosis and that the role of PFN is to mediate release of GrB from endocytic vesicles. These studies suggest that PFN can be replaced by other vesicle-disrupting factors such as those produced by adenoviruses (7–9).

Once delivered to the cytoplasm, GrB induces apoptosis by directly activating caspases and inducing rapid DNA fragmentation (10). GrB can cleave many procaspases in vitro, and has been an important tool in analyzing the maturation of caspase-3 (11), caspase-7 (12), caspase-6 (13), caspase-8 (11), caspase-9 (14), and caspase-10a/b (15, 16). Although many procaspases are efficiently cleaved in vitro, GrB-induced caspase activation occurs in a hierarchical manner in intact cells, commencing at the level of "executioner caspases" such as caspase-3, followed by caspase-7 (17). Some studies have shown that GrB activated cell death pathways through cleavage of Bid and activation of the mitochondrial death pathway in intact cells (18, 19). In addition to the caspase-mediated cytotoxic events, GrB can also rapidly translocate to the nucleus and cleave poly(ADP-ribose) polymerase and nuclear matrix antigen, using different cleavage sites than those preferred by caspases (20, 21). In addition, some studies have demonstrated that GrB can directly damage non-nuclear structures such as mitochondria, and subsequently induce cell death through a caspase-independent pathway (22, 23). Because almost all cells contain mechanisms responsible for mediating cell death (apoptosis), we propose that targeted delivery of GrB protein to the interior of cells will result in cell death through apoptotic mechanisms assuming that sufficient quantities of active enzyme can be successfully delivered to the appropriate subcellular compartment.

Recombinant single-chain Fv antibody (scFv)-based agents have been used in preclinical studies for cell-targeted delivery of cytokines (24) and intracellular delivery of highly cytotoxic n-glycosidases such as recombinant gelonin (rGel) toxin (25). The smaller size of these antibody fragments may allow better penetration into tumor tissue, improved pharmacokinetics, and a reduction in the immunogenicity observed with i.v. administered murine antibodies. To target melanoma cells, we chose a recombinant single-chain antibody designated scFvMEL which recognizes the high-molecular-weight glycoprotein gp240, found on a majority of melanoma cell lines and fresh tumor samples (26). Our group and others have demonstrated that this antibody possesses high specificity for melanoma and is minimally reactive with a variety of normal tissues, making it a promising candidate for further study (27–30). In this study, we used scFvMEL as a tumor cell-targeting carrier and designed a novel recombinant fusion construct designated GrB/scFvMEL, containing human pro-apoptotic enzyme GrB. The purpose of these studies was to determine whether we could deliver sufficient quantities of active GrB enzyme to drive cellular apoptotic events specifically in melanoma target cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 In Vitro Cytotoxic Effects...
 Discussion
 References
 
Cell Culture
Human melanoma A375-M and human breast cancer SKBR3 cell lines have been described previously (31, 32). Human cutaneous T-cell lymphoma (Hut-78) cells were obtained from the American Type Culture Collection (Manassas, VA), and cultured in RPMI 1640 containing 10% fetal bovine serum.

Cloning Human GrB and Construction of GrB-scFvMEL Fusion Genes
Human premature GrB gene was cloned from Hut-78 RNA by reverse transcription (RT)-PCR and DNA was sequenced. The fusion construct was designed in the GrB-linker-antibody format. This is in contrast to many of our other fusion constructs containing rGel or TNF which are designed within the antibody-linker-toxin format. The construction was based on an overlapping PCR method. The GrB gene was amplified by PCR using the primers NgbEK (5' to 3'): GGTACCGACGACGACGACAAGATCATCGGGGGACATGAG and Cgb (5' to 3'): GGAGCCACCGCCACCGTAGCGTTTCATGGT. These were designed to delete the signal sequence of premature GrB and to insert an enterokinase (EK) cleavage site at the NH2 terminus. The scFvMEL gene was amplified from plasmid pET-32-scFvMEL/TNF previously described (24) by PCR using the primers Nzme2 (5' to 3'): GGTGGCGGTGGCTCCACGGACATTGTGATGACCCAGTCTCAAAAATTC and Czme2 (5' to 3'): GGAGCCACCGCCACCCTCGAGCTATCATGAGGAGACGGTGAGAGTGGT.

The fused GrB-scFvMEL genes were linked together by using primers NgbEK and Czme2. To clone the fused genes into pET-32a (+) vector with an EK site at the NH2 terminus of GrB, the fragment from pET-32a (+) was amplified by using the primers T7 promoter (5' to 3'): TAATACGACTCACTATAG and CpET-32EK (5' to 3'): CTTGTCGTCGTCGTCGGTACCCAGATCTGG. The GrB-scFvMEL fusion gene was then cloned into the pET-32a (+) vector at XbaI and XhoI, designated pET-32GrB/scFvMEL. The resulting plasmid was then transformed into AD494 (DE3) pLysS for protein expression.

Induction and Expression of GrB/scFvMEL Fusion Protein in Escherichia coli
Bacteria transformed with the constructed plasmid were grown in Luria broth containing 400 µg/ml carbenicillin, 70 µg/ml chloramphenicol, and 15 µg/ml kanamycin, at 37°C overnight in a shaking incubator at 240 rpm. The cultures were then diluted 1:100 in fresh Luria broth plus antibiotics and grown to A600 nm = 0.6 at 37°C. Protein expression was induced by addition of isopropyl-1-thio-ß-D-galactopyranoside (IPTG) to a final concentration of 0.25 mM at 37°C for 1.5 h. The cells were harvested, resuspended in 40 mM Tris (pH 8.0), 300 mM NaCl, and stored at -80°C for later purification.

Purification of GrB/scFvMEL Fusion Protein
Thawed, resuspended cells were lysed by addition of lysozyme to a final concentration of 100 µg/ml and agitated for 30 min at 4°C, followed by sonication. Extracts were centrifuged at 186,000 x g for 1 h. The supernatant containing soluble protein was adjusted to 40 mM Tris, 300 mM NaCl, 5 mM imidazole, pH 8.0 and applied to a nickel-nitrilotriacetic acid (nickel-NTA) agarose column equilibrated with the same buffer. The column was washed with buffer containing 20 mM imidazole and bound proteins were eluted with buffer containing 300 mM imidazole. The protein designated Pro-GrB/scFvMEL was analyzed by absorbance (280 nm) and SDS-PAGE. Protein-containing fractions were combined and dialyzed against 20 mM Tris-HCl (pH 7.4) and 150 mM NaCl. The GrB moiety of GrB/scFvMEL was activated by adding recombinant bovine enterokinase (rEK) to remove the polyhistidine tag according to the manufacturer's instructions [1 unit of rEK cleaves 50 µg protein when incubated at room temperature (RT) for 16 h]. The rEK was removed by exposure of the solution to soybean-trypsin agarose and the protein was then further purified using Q-Sepharose resin to remove remaining contaminating proteins. The final GrB/scFvMEL product was stored at 4°C.

SDS-PAGE and Western Blot Analysis
Protein samples were analyzed by electrophoresis on an 8.5 % SDS-PAGE under reducing conditions and coomassie blue staining. Standard Western blotting was performed and probed by either mouse anti-GrB monoclonal antibody (mAb) (1.0 µg/ml, Santa Cruz Biotechnology, Santa Cruz, CA) or rabbit anti-scFvMEL polyclonal antibody (1:2000 dilution, our core lab). The blots were reacted with goat anti-mouse/horseradish peroxidase conjugate (HRP-GAM) or goat anti-rabbit/HRP conjugate (HRP-GAR) antibody, and then developed using the Amersham ECL detection system and exposed to X-ray film.

Binding Activity of GrB/scFvMEL by ELISA
Ninety-six-well ELISA plates containing adherent A375-M or SKBR3 cells (5 x 104 cells per well) were blocked by addition of a solution containing 5% BSA for 1 h and then incubated with purified GrB/scFvMEL at various concentrations for 1 h at RT. After they were washed, the cells were incubated with either mouse anti-GrB or rabbit anti-scFvMEL antibody, followed by addition of HRP-GAM or HRP-GAR antibody. Then, the substrate (2,2'-azino-bis-3-ethylbenzthiazoline-6-sulfonic acid, ABTS) solution containing 1 µl/ml 30% H2O2 was added to the wells. Absorbance at 405 nm was measured after 30 min.

Enzymatic Assay of Native GrB and GrB/scFvMEL
The enzymatic activity of the GrB component was determined in a continuous colorimetric assay using N-{alpha}-t-butoxycarbonyl-L-alanyl-L-alanyl-L-aspartyl-thiobenzyl ester (BAADT) as a specific substrate for the serine protease GrB enzymatic activity (33). Assays were performed in a total volume of 200 µl and consisted of either recombinant human GrB, GrB/scFvMEL fusion protein, or EK (control) in buffer A [0.2 M HEPES, 0.2 M NaCl, 1 mM EDTA, 0.05% (v/v) Triton X-100, pH 7.0], 0.3 mM 5,5'-dithiobis-2-nitrobenzoic acid, and 0.2 mM substrate BAADT at 25°C. The change in absorbance at A405 nm was measured on a Thermomax plate reader. Increases in sample absorbance were converted to enzymatic rates by using an extinction coefficient of 13,100 cm-1 M-1 at 405 nm. The specific activity (SA) of GrB/scFvMEL was calculated using native GrB (from Enzyme Systems Products, Livermore, CA) as the standard.

Internalization Analysis of GrB/scFvMEL by Confocal Microscopy
Cells were plated into 16-well chamber slides (Nalge Nunc International, Naperville, IL) at a density of 1 x 104 cells per well. Cells were treated with GrB/scFvMEL (40 nM) for 1 and 6 h compared with pre-blocked by ZME-018 (3 µM) for 2 h. Proteins binding to the cell surface were removed by brief incubation with glycine buffer (0.5 M NaCl, 0.1 M glycine, pH 2.5) followed by immunofluorescent staining. Cells were fixed in 3.7% formaldehyde for 15 min at RT, and permeabilized by exposure to 0.2% Triton X-100 for 10 min. Samples were blocked with 3% BSA for 1 h at RT, incubated with goat anti-GrB antibody (1: 100 dilution) at RT for 30 min, and then reacted with FITC-coupled anti-goat IgG (1: 100 dilution) and propidium iodide (PI, 2.5 µg /ml) at RT for 30 min. The slides were mounted with DABCO containing 1 µg/ml PI and analyzed under Zeiss LSM 510 confocal laser scanning microscope.

Cytotoxicity Assays in Vitro against A375-M versus SKBR3-HP Cells
Samples (GrB/scFvMEL, native GrB, PFN, or MEL sFv/rGel) were assayed using a standard 72-h cell proliferation assay with log-phase antigen-positive A375-M or antigen-negative SKBR3 cell monolayers and using crystal violet staining procedures as described previously (34). The percent of control refers to the percentage of cells in the drug-treated wells compared to that of control (untreated) wells.

Effect of GrB/scFvMEL on Cellular Apoptosis (TUNEL)
Cells (1 x 104 cells per well) were treated with GrB/scFvMEL at an IC50 (20 nM) for different time courses (2, 4, 8, and 16 h), fixed by 3.7% formaldehyde, and permeabilized by 0.1% Triton X-100, 0.1% sodium citrate. Apoptotic cells were detected by using an in situ cell death detection kit (Roche Molecular Biochemicals, Mannhein, Germany). Briefly, cells were first incubated with a terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) reaction mixture, then incubated with Converter-AP, and finally visualized by addition of catalyzing fast red substrate solution. The slide was then analyzed under a light microscope and photographs were taken with a scope-mounted Nikon digital camera (Tokyo, Japan).

Caspase-3 Cleavage Assay
A375-M cells and SKBR3 cells (2 x 105) were incubated with GrB/scFvMEL at a concentration of 50 nM for various times (0, 2, 4, 8, 16 h). Samples (30 µg of total protein) were analyzed by 12% SDS-PAGE and immunoblotting, detected using an anti-caspase-3 or cleaved caspase-3 antibody (Cell Signaling Technology, Beverly, MA).

Cytochrome c Release Apoptosis Assay
Cells (5 x 107) were treated with GrB/scFvMEL at a concentration of 50 nM for various times (0, 2, 4, 8, 16 h). Cytosol and mitochondria fractions were isolated according to the instructions for the cytochrome c release apoptosis assay kit (Oncogene, San Diego, CA). Briefly, cells were suspended in cytosol extraction buffer and homogenized. The homogenate was centrifuged at 700 x g for 10 min at 4°C. The supernatants were transferred to a fresh tube and centrifuged at 10,000 x g for 30 min at 4°C and collected as the cytosolic fraction. The pellet was resuspended in mitochondrial extraction buffer and saved as the mitochondrial fraction. Samples of each cytosolic and mitochondrial fraction isolated from non-treated and treated cells (30 µg total protein) were analyzed by 15% SDS-PAGE followed by electrophoretic transfer to a nitrocellulose membrane. The membranes were then probed by incubation with an anti-cytochrome c antibody (1 µg/ml).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 In Vitro Cytotoxic Effects...
 Discussion
 References
 
Construction of GrB/scFvMEL
We successfully obtained the human premature GrB gene that is mature GrB with signal sequence from Hut-78 RNA by reverse transcription-PCR. In the premature GrB protein, the first 20 amino acids act as a signal sequence. In cytotoxic T cells, active GrB is nominally generated by dipeptidyl peptidase I (DPPI)-mediated proteolysis (35) which removes the two-residue (Gly Glu) propeptide and exposes a terminal Ile21 residue. The NH2-terminal Ile-Ile-Gly-Gly sequence of GrB is necessary for enzymatically active GrB. In our PCR engineering design and construction of the final molecule, this enzymatic requirement dictated that the GrB protein leads the molecule followed by a flexible linker and the targeting antibody. In addition, we insured that the EK cleavage site (DDDDK) for removal of the purification tag was immediately adjacent to Ile21. The fusion gene was then introduced into the pET32a (+) bacterial expression vector to form pET32GrB/scFvMEL (Fig. 1). This vector contains a T7 promoter for high-level expression followed by a Trx.tag, a His.tag, a thrombin cleavage site, and an EK cleavage site for final removal of the protein purification tag. The sequence of the active GrB/scFvMEL was confirmed by DNA sequencing.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Construction of the GrB/scFvMEL fusion toxin by PCR and insertion into the pET-32a (+) vector. Mature GrB was attached to the recombinant scFvMEL via a flexible tether (G4S). A cleavage site for EK (DDDDK) was inserted upstream of the first amino acid (Ile) of mature GrB. The fused gene was then introduced into XbaI and XhoI sites of the pET-32a (+) vector to form the expression vector pET-32GrB/scFvMEL. Once the protein tag was removed by rEK digestion, the first residue (Ile) of mature GrB was exposed, thereby activating the GrB moiety of the fusion construct.

 
Expression and Purification of GrB/scFvMEL Fusion Protein
The recombinant protein GrB/scFvMEL was expressed as a polyhistidine-tagged protein designated pro-GrB/scFvMEL and then purified by nickel-NTA metal affinity chromatography. The his-tag was cleaved by addition of rEK to form GrB/scFvMEL and then Q-Sepharose ion exchange resin was used for final purification. One liter of bacterial culture typically yielded approximately 150 µg of the final purified GrB/scFvMEL product. SDS-PAGE showed the his-tag purification of the product migrating at the expected molecular mass of 70 kDa. The 17-kDa tag was enzymatically cleaved leaving the native GrB/scFvMEL protein migrating at 53 kDa under reducing conditions (Fig. 2A). Specificity of the cleaved fusion protein was confirmed by Western blot using either mouse anti-GrB or rabbit anti-scFvMEL antibody (Fig. 2B). Under these conditions, polyclonal anti-mouse reagents do not recognize the scFvMEL component of the construct; however, a specific polyclonal rabbit anti-scFvMEL reagent was developed for both ELISA and Western blot applications.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. SDS-PAGE and Western analyses of expression of GrB/scFvMEL in E. coli. A, 10% SDS-PAGE and coomassie blue staining under reducing conditions showed that GrB/scFvMEL construct was expressed as a 70-kDa molecule (53 + 17 kDa purification tag). The size of the final purified GrB/scFvMEL was ~53 kDa. Lane 1, non-induced bacterial cell lysate; lane 2, induced cell lysate; lane 3, pro-GrB/scFvMEL (+ tag) after purification by nickel-NTA metal affinity chromatography; lane 4, final purified GrB/scFvMEL. B, Western blotting confirmed that the fusion protein reacted with both mouse anti-GrB and rabbit anti-scFvMEL antibodies.

 
Binding Activity of scFvMEL Moiety of GrB/scFvMEL Fusion Protein
An ELISA was performed to determine the binding specificity of the GrB/scFvMEL fusion construct to antigen-positive A375-M and to antigen-negative SKBR3 cells. As shown in Fig. 3, GrB/scFvMEL specifically bound to antigen-positive A375-M cells. However, we found that anti-melanoma specificity of the molecule was preserved because the protein did not bind to antigen-negative SKBR3 cells as detected by either anti-GrB mouse mAb or by an anti-scFvMEL rabbit mAb.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. ELISA of GrB/scFvMEL on gp240 Ag-positive A375-M versus gp240 Ag-negative SKBR3 cells detected using an anti-GrB mAb. Ninety-six-well plates containing adherent A375-M or SKBR3 cells (5 x 104 cells/well) were blocked by addition of 5% BSA and then treated with purified GrB/scFvMEL at various concentrations. After washing, the cells were incubated first with anti-GrB mAb, and then with HRP-GAM. Then, substrate solution (ABTS plus 1 µl/ml 30% H2O2) was added. A405 nm was measured after 30 min.

 
Enzymatic Assay of GrB/scFvMEL
To assess the biological activity of the GrB component of the fusion construct, the ability of the enzyme to cleave a BAADT substrate was assessed and compared to native GrB as described in "Materials and Methods." The fusion construct GrB/scFvMEL was shown to have intact GrB enzymatic activity with {Delta}mA/min = 68.6 and a SA = 2.6 x 105 units/µmol. This activity was comparable to that of native GrB with {Delta}mA/min = 48.2 and a SA = 4.8 x 105 units/µmol. As expected, the GrB/scFvMEL construct containing the purification tag (i.e., before rEK digestion) and rEK itself were shown to be unable to cause hydrolysis of the BAADT substrate ({Delta}mA/min <= 5) (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Enzymatic activity of GrB moiety of fusion protein compared with native GrBa

 
Internalization of GrB/scFvMEL into Antigen-Positive A375-M Cells
The GrB moiety of the fusion construct was efficiently delivered into the cytosol of A375-M melanoma cells after treatment with GrB/scFvMEL for 1 or 6 h as assessed by confocal microscope imaging detected using goat anti-GrB antibody (Fig. 4). Significant levels of cytosolic GrB were found after treatment for 1 h and increased significantly after treatment for 6 h. Pretreatment of cells with the original anti-gp240 antibody ZME-018 followed by incubation with the GrB/scFvMEL recombinant construct was shown to completely suppress internalization of this agent. This effectively demonstrates that binding of the construct to gp240 on the tumor cell surface is responsible for internalization of the construct.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Internalization of GrB/scFvMEL into A375-M cells assessed by confocal microscopy. A375-M cells were pretreated with ZME-018 (3 µM) for 2 h, and the cells were then treated with 40 nM GrB/scFvMEL for 1 or 6 h. Molecules bound to the cell surface were removed by brief treatment with glycine buffer (pH 2.5). Cells were fixed in 3.7% formaldehyde and permeabilized in 0.2% Triton X-100. Samples were blocked with 3% BSA, incubated with goat anti-GrB mAb, and then incubated with FITC-coupled anti-goat IgG and PI. The slides were mounted with DABCO containing 1 µg/ml of PI and analyzed by Zeiss LSM 510 confocal laser scanning microscopy. A, no GrB/scFvMEL treatment control. B, pretreatment with ZME-018 (3 µM), then GrB/scFvMEL treatment for 1 h. C, pretreatment with ZME-018, then GrB/scFvMEL treatment for 6 h. D, GrB/scFvMEL treatment for 1 h. E, GrB/scFvMEL treatment for 6 h.

 

    In Vitro Cytotoxic Effects of GrB/scFvMEL
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 In Vitro Cytotoxic Effects...
 Discussion
 References
 
The cytotoxicity of GrB/scFvMEL was assessed against log-phase A375-M and SKBR3 cells in culture. A 50% growth inhibitory effect was found at a concentration of ~20 nM on A375-M cells. However, no cytotoxic effects were found on SKBR3 cells at doses of up to 1 µM (Fig. 5). By comparison, the cytotoxic effects of GrB/scFvMEL were approximately the same as that of another fusion toxin, MEL sFv/rGel on A375-M cells (Fig. 6). When A375-M cells were pretreated with ZME-018 (40 mg/ml) for 6 h and then treated with GrB/scFvMEL for 72 h, the cytotoxicity of GrB/scFvMEL was abolished (Fig. 6), thereby demonstrating a requirement for antigen recognition in the cytotoxic effect of the GrB/scFvMEL fusion construct. These data also confirm the confocal imaging data which demonstrate that pretreatment of cells with native ZME-018 can abolish internalization of this agent. In addition, the uncut GrB/scFvMEL construct or rEK showed no cytotoxicity to target cells as expected.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Cytotoxicity of the GrB/scFvMEL fusion toxin on A375-M and SKBR3. Log-phase cells were plated into 96-well plates at a density of 2.5 x 103 cells per well and allowed to attach for 24 h. The medium was replaced with medium containing different concentrations of GrB/scFvMEL. After 72 h, the effect of fusion toxin on the growth of cells in culture was determined using crystal violet staining. The IC50 of GrB/scFvMEL was ~20 nM on A375-M cells. In contrast, no cytotoxicity was observed on SKBR3 cells.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Comparative cytotoxicity of GrB/scFvMEL and MEL sFv/rGel and effect of addition of ZME-018 on cytotoxicity of GrB/scFvMEL against A375-M cells. Log-phase A375-M cells were plated into 96-well plates (2.5 x 103 cells per well) and allowed to attach for 24 h. The medium was replaced with medium containing different concentrations of GrB/scFvMEL or MEL sFv/rGel. Cells were also pretreated with ZME-018 (40 mg/ ml) for 6 h and then co-treated with various concentrations of GrB/scFvMEL. After 72 h, the cells were stained with crystal violet. Plates were read on a microplate ELISA reader at 595 nm. The IC50 of GrB/scFvMEL was approximately identical to that of MEL sFv/rGel on A375-M. ZME-018 pretreatment inhibited the cytotoxicity of GrB/scFvMEL on A375-M cells.

 
Native GrB alone at concentrations of 55 nM or PFN alone at 0.2 unit showed no significant cytotoxic effects on either A375-M or SKBR3 cells (Table 2 and Fig. 7). However, the cytotoxic effects of GrB combined with PFN against either A375-M (~72% inhibition) or SKBR3 (~65% inhibition) showed a significant cytotoxic effect compared to each agent alone (P < 0.001). This effectively demonstrates that the apoptotic effects of native GrB require PFN for translocation into the cytoplasmic compartment. Treatment of non-target SKBR3 cells with both PFN and GrB/scFvMEL also showed an increase in nonspecific apoptotic activity. On the other hand, treatment of A375-M target cells with both PFN and GrB/scFvMEL at the IC50 concentration demonstrated only a slight increase in cytotoxic effects compared to the fusion toxin alone.


View this table:
[in this window]
[in a new window]
 
Table 2. Cytotoxicity of GrB, GrB/scFvMEL alone and in combination with PFNa

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Cytotoxic effects of GrB/scFvMEL and native GrB with or without PFN on A375-M (A) and SKBR3 (B) cells. Log-phase A375-M and SKBR3 cells were treated with 55 nM of native GrB or 20 nM of GrB/scFvMEL and/or 0.2 unit of PFN for 72 h. Cells were stained with crystal violet and absorbance was measured at 595 nm. There were no cytotoxic effects of GrB or PFN alone on either A375-M or SKBR3 (<10%). When both cells were treated with GrB combined with PFN, a substantial cytotoxic effect (>60%) was observed. The fusion construct GrB/scFvMEL at the IC50 concentration demonstrated no cytotoxicity against SKBR3 cells (<10%); however, the cytotoxic effects significantly increased (~40%) when SKBR3 cells were treated with the same concentration of GrB/scFvMEL in combination with PFN.

 
In Situ Cell Death Detection (TUNEL Assay)
Both antigen-positive and antigen-negative cells were treated with an IC50 concentration of the GrB/scFvMEL fusion construct. At various times (4, 8, and 16 h) after administration, the cells were stained for apoptosis using the TUNEL assay. Apoptotic cells were observed at 8 h after treatment. Within 16 h after administration, virtually all antigen-positive cells were TUNEL positive (Fig. 8). In contrast, there were no apoptotic cells in non-target cells treated with identical doses of the fusion construct, thereby demonstrating cell specificity of the construct.



View larger version (133K):
[in this window]
[in a new window]
 
Figure 8. GrB/scFvMEL induces apoptosis on A375-M cells detected by TUNEL assay. A375-M cells were plated into a 16-well chamber slide (1 x 104 cells per well) and treated with GrB/scFvMEL at the IC50 concentration for 4, 8, and 16 h. Cells were fixed with 3.7% formaldehyde, permeabilized with 0.1% Triton X-100, 0.1% sodium citrate. Cells were incubated with the TUNEL reaction mixture, then reacted with Converter-AP, and finally visualized by catalyzing fast red substrate. The slides were analyzed by light microscopy.

 
Caspase-3 Cleavage and Cytochrome c Release
After treatment of A375 cells with the fusion construct, procaspase-3 was shown to be cleaved into one fragment (~20 kDa) at 4 h and further cleaved into smaller fragments after treatment for 8 h. In contrast, we were not able to demonstrate caspase-3 cleavage on antigen-negative SKBR3 cells treated with GrB/scFvMEL (Fig. 9). Treatment of GrB/scFvMEL was shown to result in cytochrome c translocation from the mitochondrial compartment into the cytosol by 4 h after treatment of A375-M cells but was not observed on SKBR3 cells (Fig. 10).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 9. GrB/scFvMEL induced caspase-3 cleavage on antigen-positive A375-M. A375-M and SKBR3 cells (2 x 105) were treated with GrB/scFvMEL at 50 nM for various times (2, 4, 8, and 16 h). Whole cell lysate (30 µg) was analyzed by 12% SDS-PAGE and followed by immunoblotting to detect caspase-3 or cleaved caspase-3. Pro-caspase-3 was cleaved into one fragment at 4 h and further cleaved into smaller fragments after treatment for 8 h by GrB/scFvMEL on A375-M cells. We found no caspase-3 cleavage on SKBR3 cells treated with GrB/scFvMEL.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 10. Cytochrome c released from mitochondria to cytosol by GrB/scFvMEL on A375-M. Cells (5 x 107) were treated with GrB/scFvMEL at 50 nM for various times (2, 4, 8, and 16 h). Cells were collected, and the cytosolic and mitochondrial fractions were isolated. Fractions (30 µg) from nontreated and treated cells were analyzed by 15% SDS-PAGE and immunoblotting, detected with an anti-cytochrome c antibody. Cytochrome c was found to be released on A375-M cells but not on SKBR3 cells after 4 h treatment by GrB/scFvMEL.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 In Vitro Cytotoxic Effects...
 Discussion
 References
 
The successful development of tumor-targeted therapeutic agents heavily depends on incorporation of agents within the structure of the targeting molecule which function to modify cell growth. Antibody-guided drug molecules generally require chemical conjugation through a linker to the targeting platform such as an antibody and release of the active molecule once in close proximity to or within the target cell (36). In the case of chemical conjugates, premature linker release of cytotoxic agents can result in nonspecific toxicity limiting the effectiveness of targeted therapeutics. On the other hand, linkers that are too stable can fail to release the active agent in a timely manner, thereby compromising the effectiveness of the successfully delivered agent (37). In the case of protein-based enzymatic toxins such as pseudomonas exotoxin (PE), gene fusion of the toxin to a cell-targeting carrier molecule results in an enzymatically inactive molecule requiring proteolytic release from the carrier molecule once inside the cell to reattain enzymatic activity (38). The use of fusion toxins requiring enzymatic release for reacquisition of enzymatic activity could, at least in theory, result in escape of tumor cells resistant to the toxin by virtue of their inability to activate the fusion protein once inside the cytoplasmic compartment. The use of cytotoxic fusion proteins such as rGel (25, 39) toxin, cytokines such as TNF (24, 40), and enzymes such as GrB avoids this requirement because they are biologically active even when fused to the cell-targeting carrier molecule.

This study clearly demonstrates the biological activity of a new class of tumor-targeted enzymes that are cytotoxic to target cells because they are capable of direct activation of a preexisting, nascent cellular pro-apoptotic pathway. Although several groups have generated antibody-enzyme chemical conjugates and fusion constructs, the purpose of the majority of these targeted enzymes has been to locally convert inactive pro-drugs to active therapeutic agents (41). The primary types of directly cytotoxic enzymes commonly delivered by cell-targeting proteins such as antibodies and growth factors usually fall into the class of ribosome-inhibiting proteins (RIPs). Toxins such as pseudomonas exotoxin (PE) and gelonin (rGel) have been successfully used because only a few molecules are needed to irretrievably intoxicate a target cell (25, 38, 39). Recently, Newton et al. (42) described a new class of immunoconjugates containing human RNase which has in vitro and in vivo cytotoxic activity against human tumor cell lines and xenografts primarily through direct degradation of RNA. The current construct, to our knowledge, is one of the first descriptions of a targeted enzymatic agent that operates primarily through activation of the pro-apoptotic cascade process.

We were encouraged to note that the GrB/scFvMEL fusion construct demonstrated equivalent cytotoxic effects in vitro on target cells compared to a fusion toxin containing a highly potent plant n-glycosidase such as recombinant gelonin. Studies in our laboratory have demonstrated that the MEL sFv/rGel fusion construct operates through a necrotic rather than an apoptotic process (41). These comparative studies demonstrate that the robust cytotoxic effects of the rGel toxin can apparently be matched by that of the GrB apoptotic effects when the two agents are delivered by the identical targeting antibody.

For the effective utilization of GrB as a fusion toxin, understanding the role of PFN is critical. CTLs, when in proximity to target cells, first release monomeric PFN into the extracellular space between the two cells which then polymerizes into pores in the target cell membrane and which allow subsequently released GrB entry into the target cell cytoplasm. Recent studies have suggested that the mannose-6-phosphate receptor (43) could also provide GrB entry by receptor-mediated endocytosis (7) and that under these circumstances, PFN may act to release endosomal GrB into the cytosol of the target cell (8). The current study clearly demonstrates that an antibody delivery vehicle can provide cellular entry access for GrB specifically on antigen-positive cells and is capable of delivering the enzyme to cytoplasm without the need for PFNs. Moreover, the delivery vehicle can provide enzyme concentrations in the cytoplasm that are apparently sufficient to drive apoptosis. The anti-gp240 scFv antibody used has been well studied in our laboratory and is capable of internalizing and delivering attached proteins such as toxins into the cytoplasm of target cells although the exact mechanism by which this particular antibody internalizes has not been fully elucidated. Although nonspecific cellular entry of the GrB could possibly be mediated by the mannose-6-phosphate receptor, the recombinant GrB protein used in our construct is not glycosylated thereby reducing the likelihood of uptake by antigen-negative cells.

The apoptotic effects induced by GrB delivered by PFN appears to be a rapid process requiring approximately 1 h to result in the hallmarks of apoptosis such as DNA fragmentation, caspase cleavage, and cytochrome c release (44). This is in contrast to our studies with the GrB fusion construct which demonstrates activation of multiple pro-apoptotic mechanisms initiating approximately 4 h after treatment of target cells and culminating approximately 8 h later in apoptotic effects as assessed by TUNEL staining. The temporal differences observed between the apoptotic effects of GrB delivered to the cytoplasm via antibody-mediated internalization compared to the more rapid apoptotic effect generated by PFN-mediated GrB entry probably reflect the time required for the antibody component of the fusion construct to bind to the cell surface, internalize into the cell, translocate GrB to the cytoplasm, and deliver a sufficient concentration of GrB to drive the pro-apoptotic cascade.

The cytotoxicity/apoptosis we observed on antigen-positive cells after treatment with the GrB-containing fusion construct also suggests that tumor cells contain sufficient pro-apoptotic substrates capable of activation by an abundance of GrB and suggests that there appears to be no downstream control-point mechanisms nominally in place to prevent pharmacologically directed apoptosis using this particular mechanistic approach. These studies show that the cytotoxic/apoptotic events observed after treatment of target cells with the fusion construct are the result of both caspase-dependent and caspase-independent mechanisms and it will be interesting to determine whether this new class of agents has additive or synergistic interactions with conventional therapeutic modalities such as chemotherapeutic agents, biological agents, or radiotherapeutic agents. It also remains to be determined whether there are cellular resistance mechanisms capable of protecting cells against GrB-containing targeted therapeutic agents. Finally, still to be determined is whether there are specific cell types that may be inherently or iatrogenically resistant to this cytotoxic approach.


    Acknowledgments
 
We thank Michelle McCall and Julie Merchant for their excellent assistance in the preparation of this manuscript.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Research conducted, in part, by the Clayton Foundation for Research.

Received 2/ 4/03; revised 9/23/03; accepted 10/ 1/03.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 In Vitro Cytotoxic Effects...
 Discussion
 References
 

  1. Lobe, C. G., Havele, C., and Bleackley, R. C. Cloning of two genes that are specifically expressed in activated cytotoxic T lymphocytes. Proc. Natl. Acad. Sci. USA, 83: 1448–1454, 1986.[Abstract/Free Full Text]
  2. Trapani, J. A., Klein, J., White, P. C., and Dupont, B. Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes. Proc. Natl. Acad. Sci. USA, 85: 6924–6928, 1988.[Abstract/Free Full Text]
  3. Henkart, P. A. Mechanism of lymphocyte-mediated cytotoxicity. Annu. Rev. Immunol., 3: 31–58, 1985.[CrossRef][Medline]
  4. Smyth, M. J. and Trapani, J. A. Granzymes: exogenous proteinases that induce target cell apoptosis. Immunol. Today, 16: 202–206, 1995.[CrossRef][Medline]
  5. Podack, E. R. Perforin: structure, function, and regulation. Curr. Top. Microbiol. Immunol., 178: 175–184, 1992.[Medline]
  6. Yagita, H., Nagata, M., Kawasaki, A., Shinkai, Y., and Okumura, K. Role of perforin in lymphocyte-mediated cytolysis. Adv. Immunol., 51: 215–242, 1992.[Medline]
  7. Froelich, C. J., Orth, K., Turbov, J., Seth, P., Gottleib, R., Babior, B., Shah, G. M., Bleackley, R. C., Dixit, V. M., and Hanna, W. New paradigm for lymphocyte granule-mediated cytotoxicity: target cells bind and internalize granzyme B, but an endosomolytic agent is necessary for cytosolic delivery and subsequent apoptosis. J. Biol. Chem., 271: 29073–29079, 1996.[Abstract/Free Full Text]
  8. Pinkoski, M. J., Hobman, M., Heibein, J. A., Tomaselli, K., Li, F., Seth, P., Froelich, C. J., and Bleackley, R. C. Entry and trafficking of granzyme B in target cells during granzyme B-perforin-mediated apoptosis. Blood, 92: 1044–1054, 1998.[Abstract/Free Full Text]
  9. Browne, K. A., Blink, E., Sutton, V. R., Froelich, C. J., Jans, D. A., and Trapani, J. A. Cytosolic delivery of granzyme B by bacterial toxins: evidence that endosomal disruption, in addition to transmembrane pore formation, is an important function of perforin. Mol. Cell. Biol., 19: 8604–8615, 1999.[Abstract/Free Full Text]
  10. Shi, L., Kraut, R. P., Aebersold, R., and Greenberg, A. H. A natural killer cell granule protein that induces DNA fragmentation and apoptosis. J. Exp. Med., 175: 553–566, 1992.[Abstract/Free Full Text]
  11. Darmon, A. J., Nicholson, D. W., and Bleackley, R. C. Activation of the apoptotic protease CPP32 by cytotoxic T-cell-derived granzyme B. Nature, 377: 446–448, 1995.[CrossRef][Medline]
  12. Gu, Y., Sarnecki, C., Fleming, M. A., Lippke, J. A., Bleackley, R. C., and Su, M. S. S. Processing and activation of CMH-1 by granzyme B. J. Biol. Chem., 271: 10816–10820, 1996.[Abstract/Free Full Text]
  13. Orth, K., Chinnaiyan, A. M., Garg, M., Froelich, C. J., and Dixit, V. M. The CED-3/ICE-like protease Mch2 is activated during apoptosis and cleaves the death substrate lamin A. J. Biol. Chem., 271: 16443–16446, 1996.[Abstract/Free Full Text]
  14. Duan, H. J., Orth, K., Chinnaiyan, A. M., Poirier, G. G., Froelich, C. J., He, W. W., and Dixit, V. M. ICE-LAP6, a novel member of the ICE/ced-3 gene family, is activated by the cytotoxic T cell protease granzyme B. J. Biol. Chem., 271: 16720–16724, 1996.[Abstract/Free Full Text]
  15. Fernandes-Alnemri, T., Armstrong, R. C., Krebs, J., Srinivasula, S. M., Wang, L., Bullrich, F., Fritz, L. C., Trapani, J. A., Tomaselli, K. J., Litwack, G., and Alnemri, E. S. In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc. Natl. Acad. Sci. USA, 93: 7464–7469, 1996.[Abstract/Free Full Text]
  16. Vincenz, C. and Dixit, V. M. Fas-associated death domain protein interleukin-1ß-converting enzyme 2 (FLICE2), an ICE/ced-3 homologue, is proximally involved in CD95- and p55-mediated death signaling. J. Biol. Chem., 272: 6578–6583, 1997.[Abstract/Free Full Text]
  17. Yang, X., Stennicke, H. R., Wang, B., Green, D. R., Janicke, R. U., Srinivasan, A., Seth, P., Salvesen, G. S., and Froelich, C. J. Granzyme B mimics apical caspases. Description of a unified pathway for trans-activation of executioner caspase-3 and -7. J. Biol. Chem., 273: 34278–34283, 1998.[Abstract/Free Full Text]
  18. Sutton, V. R., Davis, J. E., Cancilla, M., Johnstone, R. W., Ruefli, A. A., Sedelies, K., Browne, K. A., and Trapani, J. A. Initiation of apoptosis by granzyme B requires direct cleavage of bid, but not direct granzyme B-mediated caspase activation. J. Exp. Med., 192: 1403–1414, 2000.[Abstract/Free Full Text]
  19. Barry, M. and Bleackley, C. Cytotoxic T lymphocytes: all roads lead to death. Nat. Rev. Immunol., 2: 401–409, 2002.[Medline]
  20. Jans, D. A., Jans, P., Briggs, L. J., Sutton, V., and Trapani, J. A. Nuclear transport of granzyme B (fragmentin-2). Dependence on perforin in vivo and cytosolic factors in vitro. J. Biol. Chem., 271: 30781–30789, 1996.[Abstract/Free Full Text]
  21. Trapani, J. A., Browne, K. A., Smyth, M. J., and Jans, D. A. Localization of granzyme B in the nucleus. J. Biol. Chem., 271: 4127–4133, 1996.[Abstract/Free Full Text]
  22. Trapani, J. A., Jans, D. A., Jans, P. J., Smyth, M. J., Browne, K. A., and Sutton, V. R. Efficient nuclear targeting of granzyme B and the nuclear consequences of apoptosis induced by granzyme B and perforin are caspase-dependent, but cell death is caspase-independent. J. Biol. Chem., 273: 27934–27938, 1998.[Abstract/Free Full Text]
  23. Heibein, J. A., Barry, M., Motyka, B., and Bleakley, R. C. Granzyme B-induced loss of mitochondrial inner membrane potential ({Delta}{psi}m) and cytochrome c release are caspase independent. J. Immunol., 163: 4683–4693, 1999.[Abstract/Free Full Text]
  24. Liu, Y., Cheung, L. H., and Rosenblum, M. G. Mechanistic studies of the cytotoxic action of the antimelanoma fusion toxin scFvMEL/TNF. Proc. Am. Assoc. Cancer Res., 43: 913 (Abstract # 4525), 2002.
  25. Rosenblum, M. G., Cheung, L. H., Liu, Y., and Marks, J. W., 3rd. Design, expression, purification, and characterization, in vitro and in vivo, of an antimelanoma single chain Fv antibody fused to the toxin gelonin. Cancer Res., 63: 3995–4002, 2003.[Abstract/Free Full Text]
  26. Kantor, R. R., Ng, A. K., Giacomini, P., and Ferrone, S. Analysis of the NIH workshop monoclonal antibodies to human melanoma antigens. Hybridoma, 1: 473–482, 1982.[Medline]
  27. Macey, D. J., Denardo, S. J., Denardo, G. L., Goodnight, J. K., and Unger, M. W. Uptake of indium-111-labeled monoclonal antibody ZME-018 as a function of tumor size in a patient with melanoma. Am. J. Physiol. Imag., 3: 1–6, 1988.[Medline]
  28. Koizumi, M., Endo, K., Watanabe, Y., Saga, T., Sakahara, H., and Konishi, J. Immunoscintigraphy and pharmacokinetics of indium-111-labeled ZME-018 monoclonal antibody in patients with malignant melanoma. Jpn. J. Cancer Res., 79: 973–981, 1988.[Medline]
  29. Rosenblum, M. G., Murray, J. L., Cheung, L., Rifkin, R., Salmon, S., and Bartholomew, R. A. Specific and potent immunotoxin composed of antibody ZME-018 and the plant toxin gelonin. Mol. Biother., 3: 6–13, 1991.[Medline]
  30. Mujoo, K., Cheung, L., Murray, J. L., and Rosenblum, M. G. Pharmacokinetics, tissue distribution, and in vivo antitumor effects of the anti-melanoma immunotoxin ZME-gelonin. Cancer Immunol. Immunother., 40: 339–345, 1995.[Medline]
  31. Rosenblum, M. G., Cheung, L., Mujoo, K., and Murray, J. L. An antimelanoma immunotoxin containing recombinant human tumor necrosis factor: tissue disposition, pharmacokinetics, and therapeutic studies in xenograft models. Cancer Immunol. Immunother., 40: 322–328, 1995.[Medline]
  32. Rosenblum, M. G., Horn, S. A., and Cheung, L. H. A novel recombinant fusion toxin targeting HER-2/neu-overexpressing cells and containing human tumor necrosis factor. Int. J. Cancer, 88: 267–273, 2000.[CrossRef][Medline]
  33. Poe, M., Blake, J. T., Boulton, D. A., Gammon, M., Sigal, N. H., Wu, J. K., and Zwerink, H. J. Human cytotoxic lymphocyte granzyme B. J. Biol. Chem., 266: 98–103, 1991.[Abstract/Free Full Text]
  34. Nishikawa, K., Rosenblum, M. G., Newman, R. A., Pandita, T., Hittelman, W. N., and Donato, N. J. Resistance of human cervical carcinoma cells to tumor necrosis factor correlated with their increased sensitivity to cisplatin: evidence of a role for epidermal growth factor receptor. Cancer Res., 52: 4758–4765, 1992.[Abstract/Free Full Text]
  35. Smyth, M. J., McGuire, M. J., and Thia, K. Y. Expression of recombinant human granzyme B. A processing and activation role for dipeptidyl peptidase I. J. Immunol., 154: 6299–6305, 1995.[Abstract]
  36. Appelbaum, F. R. Antibody-targeted therapy for myeloid leukemia (review). Semin. Hematol., 36 (Suppl. 6): 2–8, 1999.[Medline]
  37. Dosio, F., Brusa, P., Delprino, L., Grosa, G., Ceruti, M., and Cattel, L. A new approach in the synthesis of immunotoxins: ribosome inactivating protein noncovalently bound to monoclonal antibody. J. Pharm. Sci., 83: 206–211, 1994.[CrossRef][Medline]
  38. Tallman, M. S. Monoclonal antibody therapies in leukemias. Semin. Hematol., 39 (Suppl. 3): 12–19, 2002.[CrossRef][Medline]
  39. Veenendaal, L. M., Jin, H., Ran, S., Cheung, L., Navone, N., Marks, J. W., Waltenberger, J., Thorpe, P., and Rosenblum, M. G. In vitro and in vivo studies of a VEGF121/rGel chimeric fusion toxin targeting the neovasculature of solid tumors. Proc. Natl. Acad. Sci. USA, 99: 7866–7871, 2002.[Abstract/Free Full Text]
  40. Scherf, U., Benhar, I., Webber, K. O., Pastan, I., and Brinkmann, U. Cytotoxic and antitumor activity of a recombinant tumor necrosis factor-B1 (Fv) fusion protein on Ley antigen-expression human cancer cells. Clin. Cancer Res., 2: 1523–1531, 1996.[Abstract]
  41. Ferguson, M. J., Ahmed, F. Y., and Cassidy, J. The role of pro-drug therapy in the treatment of cancer. Drug Resist. Updat., 4: 225–232, 2001.[CrossRef][Medline]
  42. Newton, D. L., Hansen, H. J., Liu, H., Ruby, D., Iordanov, M. S., Magun, B. E., Goldenberg, D. M., and Rybak, S. M. Specifically targeting the CD22 receptor of human B-cell lymphomas with RNA damaging agents. Crit. Rev. Oncol./Hematol., 39: 79–86, 2001.[Medline]
  43. Motyka, B., Korbutt, G., Pinkoski, M. J., Heibein, J. A., Caputo, A., Hobman, M., Barry, M., Shostak, I., Sawchuk, T., Holmes, C. F., Gauldie, J., and Bleackley, R. C. Mannose-6-phosphate/insulin-like growth factor II receptor is a death receptor for granzyme B during cytotoxic T-cell-induced apoptosis. Cell, 103: 491–500, 2000.[CrossRef][Medline]
  44. Johnson, H., Scorrano, L., Korsmeyer, S. J., and Ley, T. J. Cell death induced by Granzyme C. Blood, 101: 3093–3101, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Ann. Surg. Oncol.Home page
H. Kashiwagi, J. E. McDunn, P. S. Goedegebuure, M. C. Gaffney, K. Chang, K. Trinkaus, D. Piwnica-Worms, R. S. Hotchkiss, and W. G. Hawkins
TAT-Bim Induces Extensive Apoptosis in Cancer Cells
Ann. Surg. Oncol., May 1, 2007; 14(5): 1763 - 1771.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
H.-Y. Qin, R. Mukherjee, E. Lee-Chan, C. Ewen, R. C. Bleackley, and B. Singh
A novel mechanism of regulatory T cell-mediated down-regulation of autoimmunity
Int. Immunol., July 1, 2006; 18(7): 1001 - 1015.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Laforge, N. Bidere, S. Carmona, A. Devocelle, B. Charpentier, and A. Senik
Apoptotic Death Concurrent with CD3 Stimulation in Primary Human CD8+ T Lymphocytes: A Role for Endogenous Granzyme B
J. Immunol., April 1, 2006; 176(7): 3966 - 3977.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. C. Kurschus, R. Bruno, E. Fellows, C. S. Falk, and D. E. Jenne
Membrane receptors are not required to deliver granzyme B during killer cell attack
Blood, March 1, 2005; 105(5): 2049 - 2058.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Y.
Right arrow Articles by Rosenblum, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Y.
Right arrow Articles by Rosenblum, M. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics